Nucleotide(nt) sequences were determined for the toxin (SHT) operon present in the chromosome of Shigella dysenteriae 1 and for the shiga-like toxin (SLT) operon found in the lambdoid phage H30 genome. The coding sequences of the sht and slt genes differ in 4 nt with 1 nt change responsible for an amino acid replacement. The deduced amino acid sequence in the A chain of the toxins is highly homologous to that of the A chain of ricin, a plant toxin. SHT-coding mRNAs were detected by mapping the 5' termini and using blot-hybridisation; one of them was more abundant and coded only for the B subunit of SHT while the other (bi-cistronic mRNA) encoded both subunits. An IS element related to the IS3 element of Escherichia coli was found in the chromosome of S. dysenteriae near the sht operon.

Amino Acid Sequence↗

PubMed1988

The nucleotide sequence of bacteriophage T5 DNA at the region between early and late genes.

Explore the source record for details and available documents.

Bacteriophages↗

PubMed1987

Nucleotide sequence of the bacteriophage T5 DNA fragment containing a distal part of tRNA gene region.

Explore the source record for details and available documents.

Base Sequence↗

PubMed1986

Nucleotide sequence of the bacteriophage T5 DNA fragment which contains the gene for tRNAAsp.

The nucleotide sequence of bacteriophage T5 tRNAAsp has been determined by conventional methods using thin-layer chromatography on cellulose for oligonucleotide fractionation. It exhibits several unusual features, such as (a) the displacement of the constant residues U-8, A-14 and R-15; (b) the presence of three G X U out of four base pairs in the D-stem. The gene for T5 tRNAAsp has been cloned in pBR 322 and sequenced. The analysis of the flanking regions shows the presence of two open reading frames on both sides of this gene. It has also been shown that the cloned gene is expressed in Escherichia coli, and RNase P is involved in the T5 tRNAAsp processing.

Base Sequence↗

PubMed1986

Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5.

The nucleotide sequence of the BalI-PstI fragment of T5 DNA, 1347 bp in length, coding for 5'-exonuclease (D15 gene), has been determined. A coding region of the gene contains 873 bp and is preceded by a typical Shine-Dalgarno sequence. The D15 gene belongs to a cluster, consisting of at least 3 genes, in which a termination codon of a preceding gene overlaps an initiation codon of the following one. The sequence contains an open reading frame for 291 amino acid residues. The molecular mass of the 5'-exonuclease calculated from the predicted amino acid sequence is 33 400 Da.

Amino Acid Sequence↗

PubMed1986

NMR studies of DNA recognition sequences and their interaction with proteins. The phage lambda OR1 operator, a symmetric lac operator and their specific complexes with cro protein and lac repressor "headpiece".

The phage lambda operator OR1 and a 18 base pair symmetric lac operator have been studied by high resolution NMR. The imino proton resonances and the resonances of the unexchangeable protons (except the 5' and 5" sugar proton resonances) have been assigned by one- and two-dimensional NOE techniques. The imino proton resonances of OR1 and the symmetric lac operator have been used to monitor changes induced in the operator structure by the formation of a specific complex with the phage lambda cro protein and with the lac repressor N-terminal DNA binding domain ("headpiece"). Two regions within the OR1 sequence could be identified, where changes in the imino proton resonance positions occur: The central part around base pairs CG 9 and 10 and the region around base pairs AT 5 and CG 5. The TA base pair 6 is the only position in the symmetric lac operator, where the complex formation with headpiece induces a change.

Bacteriophage lambda↗

PubMed1985

Interaction of EcoRII restriction and modification enzymes with synthetic DNA fragments. VI. The binding and cleavage of substrates containing nucleotide analogs.

The present study deals with the binding and cleavage by EcoRII endonuclease of concatemer DNA duplexes containing EcoRII recognition sites (formula; see text) in which dT is replaced by dU or 5-bromodeoxyuridine, or 5'-terminal dC in the dT-containing strand is methylated at position 5. The enzyme molecule is found to interact with the methyl group of the dT residue of the DNA recognition site and to be at least in proximity to the H5 atom of the 5'-terminal dC residue in dT-containing strand of this site. Modification of any of these positions exerts an equal effects on the cleavage of both DNA strands. Endonuclease EcoRII was found to bind the substrate specifically. At the same time modification of the bases in recognized sequence may result in the formation of unproductive, though stable, enzyme-substrate complexes.

Base Sequence↗

PubMed1985

The nucleotide sequence of bacteriophage T5 leucine tRNA.

Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh. This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively.

Base Sequence↗

PubMed1984

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA.

Uniformly 32P-labeled phage-specific tRNAGln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAG psi CGAGAUCAUUGGT psi CAAAUCCAAUAUCCCCUGCCAOH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5'-terminal base and the fifth base from its 3'-end. The structure of tRNA was confirmed by DNA sequencing of its gene.

Base Sequence↗

PubMed1984

1H NMR study of the interaction of bacteriophage lambda Cro protein with the OR3 operator. Evidence for a change of the conformation of the OR3 operator on binding.

The specific complex between the lambda phage OR3 operator and the Cro protein has been studied by proton NMR spectroscopy at 500 MHz. The DNA imino proton resonances of this complex have been assigned to specific base pairs using the known assignments of these resonances for the free operator. Increase of the protein/DNA ratio to complete saturation of the OR3 operator with the Cro protein made it possible to follow the shift changes of the resonances. Ambiguities were resolved by nuclear Overhauser effect measurements on the complex. The shifts of the imino proton resonance positions provide information on the changes induced in the conformation of the operator upon complex formation with a dimer of the Cro protein. The most striking shift occurs for the central (GC 9) base pair, which is known to have no direct contacts with the Cro protein. This shift may be induced by a bend in the OR3 operator DNA at the GC 9 base pair to accommodate the operator for the binding of the Cro protein dimer. The imino proton resonances of two additional base pairs can be observed in the complex, demonstrating an overall stabilization of the DNA structure by the binding of the Cro protein.

Bacteriophage lambda↗

PubMed1984

Structural organization of transposable element mdg4 from Drosophila melanogaster and a nucleotide sequence of its long terminal repeats.

A mobile dispersed genetic element, mdg4 , approximately 7.5 kilobases (kb) long has been cloned from D. melanogaster genome. Chromosomal bands have only few sites of mdg4 , but it always hybridizes to the chromocenter. The location of mdg4 varies among D. melanogaster strains. Blot hybridization shows that, in contrast to other mdg elements, mdg4 sequences are rather heterogeneous. Only few copies are full-length. A strong amplification of mdg4 has occurred during the in vitro cultivation of cells involving only one mdg4 variant. Long terminal repeats (LTRs) and flanking sequences have been sequenced in two cloned copies of transposable element mdg4 . In both cloned copies of mdg4 , LTRs have an identical nucleotide sequence 479 bp long. The mdg4 is flanked by four-base-pair direct repeats, short mismatched palindromes being present at the ends of each LTR. The termini of the mdg4 body contain an oligopurine stretch and a region partially complementary to D. melanogaster tRNA-Lys. Thus, structural organization of mdg4 LTRs is similar to that of several other mdg elements and retroviral proviruses.

Animals↗

PubMed1984

Structure and function of the nontranscribed spacer regions of yeast rDNA.

The sequences of the nontranscribed spacers (NTS) of cloned ribosomal DNA (rDNA) units from both Saccharomyces cerevisiae and Saccharomyces carlsbergensis were determined. The NTS sequences of both species were found to be 93% homologous. The major disparities comprise different frequencies of reiteration of short tracts of six to sixteen basepairs. Most of these reiterations are found within the 1100 basepairs long NTS between the 3'-ends of 26S and 5S rRNA (NTS1). The NTS between the starts of 5S rRNA and 37S pre-rRNA (NTS2) comprises about 1250 basepairs. The first 800 basepairs of NTS NTS2 (adjacent to the 5S rRNA gene) are virtually identical in both strains whereas a variable region is present at about 250 basepairs upstream of the RNA polymerase A transcription start. In contrast to the situation in Drosophila and Xenopus no reiterations of the putative RNA polymerase A promoter are present within the yeast NTS. The strands of the yeast NTS reveal a remarkable bias of G and C-residues. Yeast rDNA was previously shown to contain a sequence capable of autonomous replication (ARS) (Szostak, J.W. and Wu, R (1979), Plasmid 2, 536-554). This ARS, which may correspond to a chromosomal origin of replication, was located on a fragment of 570 basepairs within NTS2.

Animals↗

PubMed1984

Identification of bacterial clones encoding bovine caseins by direct immunological screening of the cDNA library.

A sensitive immunoassay was used to identify recombinant plasmids carrying cDNA fragments of bovine caseins in the cDNA library from bovine mammary gland mRNA. Colonies grown on nitrocellulose filters were lysed in situ and proteins from the lysates were blotted onto CNBr-activated cellulose filter paper. Antigens covalently bound to CNBr-activated paper or bound to nitrocellulose filters were detected by reaction with antiserum to caseins, followed by 125I-labelled Staphylococcus aureus protein A and autoradiography. Six clones were found positive among 5400 of the cDNA library: 3-A1, 3-B2, 3-B5, 3-H7, 2-A5 and 2-C9. The molecular weights of chimeric pre-beta-lactamase: casein proteins synthesized in Escherichia coli were estimated by immunoblotting. Colony hybridization and nucleotide sequence analysis showed that clone 3-B5 contained a cDNA fragment of bovine chi-casein, clone 3-H7 contained a cDNA fragment of beta-casein, while clones 2-A5 and 2-C9 carried cDNA fragments of alpha s1-casein.

Animals↗

PubMed1984

Lambda phagemids and their transducing properties.

Two recombinant lambda DNAs, lambda gt::pMB9 and lambda NM::pBR322, containing, respectively, the pMB9 and pBR322 replicon were constructed and characterized. Both constructs (phagemid DNAs) transfect Escherichia coli cells, producing mature infectious phage progenies. Alternatively, drug-resistant colonies of transductants can be selected upon infection with these phages (phagemid particles) that maintain phagemid DNA in the cell in the form of covalently closed circular plasmids. The efficiency of transduction for nonlysogenic E. coli strains with lambda gt::pMB9 phage producing lambda repressor cIts ranges from 10(-7) to 10(-2) transductant colonies per input phage, depending on the temperature and strain used, while lambda NM::pBR322 phage carrying imm21 transduces with a frequency of up to 1. This means that each lambda NM::pBR322 phagemid particle is capable of establishing itself in the cell as a nonlethal plasmid, permitting formation of a resistant bacterial colony. The maximal level of transduction with lambda gt::pMB9 was obtained when E. coli cells lysogenic for lambda were used. Thus, we believe that the efficiency of transduction is determined by the turn-on of the phage repressor in the transductant. In addition, we have found that all lambda gt::pMB9-containing transductants under certain conditions harbor precisely excised pMB9; excision of pBR322 from lambda NM::pBR322 has not been observed.

Bacteriophage lambda↗