PubMed Health⌕ Search

Biomedical subjects

A B Deisseroth

Publications and source records attributed to A B Deisseroth.

At least 91 records · Page 5Linked to original sources
PubMed1994

Interaction of nuclear proteins with an AP-1/CRE-like promoter sequence in the human TNF-alpha gene.

The tumor necrosis factor alpha (TNF-alpha) promoter contains an AP-1/CRE-like binding site, TGAGCTCA. AP-1 elements generally transduce signals involving protein kinase C; the CRE site mediates a cAMP response, involving protein kinase A. Thus, this element has the potential to receive signals through divergent signaling pathways. Nuclear protein binding studies using extracts from THP-1 monocytic cells treated with lipopolysaccharide (LPS), which stimulates, or dexamethasone (Dex) or pentoxifylline (PTX), which inhibit TNF production, respectively, suggest that two low-mobility complexes could be involved in regulation through this promoter region. PTX and Dex increase binding of both these complexes compared with untreated cells; approximately 2 hours after LPS induction, the upper complex becomes undetectable. This upper complex is composed of ATF2 (activating transcription factor 2, a cyclic AMP responsive element binding protein) homodimers; the lower is a heterodimer of jun/ATF2. LPS induces c-jun and thus may enhance formation of jun/ATF2 complexes, which could be activating complexes. In this case, the simultaneous presence of both complexes, which would occur in the presence of Dex or PTX, could reduce the amount of TNF transcription through competitive binding. Through in vitro competitive binding studies comparing the binding affinities of the TNF promoter sequence and a consensus CRE, we further suggest how variation of endogenous binding sequences from consensus may be an important property for regulatory control of particular genes.

Activating Transcription Factor 1↗
PubMed1994

5q- chromosome. Evidence for complex interstitial breaks in a case of refractory anemia with excess blasts.

Interstitial loss of the long arm of chromosome 5 (5q-) is an anomaly frequently seen in myelodysplasia (MDS) and acute myelogenous leukemia (AML). Although the limits of the interstitial deletions vary among patients, there is a critical region of overlap at 5q31 that is consistently deleted in most cases. The order of genes in the critical 5q31 region is centromere, interleukin gene cluster, an anonymous polymorphic locus D5S89, early growth response factor, CSF1 receptor, telomere. Fluorescence in situ hybridization of specific 5q31 probes to metaphases with del(5) (q11q31) from a patient with secondary refractory anemia with excess blasts in transformation demonstrates that the interstitial deletion is not contiguous. The 5q- chromosome has lost the D5S89 and CSF1R loci while retaining some of the sequences in between. A probe derived from a 300-kbp yeast artificial chromosome containing the D5S89 locus is interrupted on the normal chromosome 5 of this patient. Data presented in this report are consistent with (i) presence of a critical gene within the YAC and (ii) more than a single interstitial break within the 5q- chromosome. These results, while pinpointing one of the critical 5q31 loci, also provide evidence for a second telomeric locus.

Anemia, Refractory, with Excess of Blasts↗
PubMed1994

Development of a sensitive PCR to detect allele loss in a model hematopoietic neoplasm.

Loss or gain of an entire chromosome and interstitial deletions or amplifications are hallmarks of several hematopoietic neoplasms. These chromosomal anomalies can be identified by conventional cytogenetic analysis of bone marrow aspirates. We have developed a PCR-based assay to detect loss of chromosome 5q31 loci, in the model system of myeloid disorders with the 5q- chromosome (interstitial deletion of 5q), by taking advantage of a highly polymorphic dinucleotide repeat within the interleukin-9 (IL9) gene on 5q31. In a given sample, quantitation of amplification of individual alleles in a Phosphorimager allowed the representation of alleles to be expressed as a ratio of the larger to the smaller allele. Comparison of these ratios in paired DNA samples from Ficoll buoyant and pelletted fractions provides evidence for allele loss. Results presented here demonstrate that this technique of comparison of ratios of isotope incorporation could be expanded to Investigate any deletion or numerical abnormality in hematopoietic tumors.

Alleles↗
PubMed1994

Conformational change of p53 protein in growth factor-stimulated human myelogenous leukemia cells.

Frequent point mutations of the p53 tumor suppressor gene have been detected in solid tumors but not in acute myelogenous leukemia (AML). The inactivation of the suppressor function of the p53 protein in AML cells may be achieved through the acquisition of a mutant-like conformation. We provide evidence in this report that the p53 protein in AML cells switches to a mutant-like conformation in response to growth factor stimulation, and we propose that the conformation of p53 protein is one of the molecular mechanisms in determining whether the cells proliferate or enter apoptosis. We also show that wild-type p53 with mutant-like conformation is not equivalent to mutant p53 in their stability, which is consistent with the fact they have very different biological activities in the cells.

Apoptosis↗
PubMed1994

Large-scale preparation of highly purified, frozen/thawed CD34+, HLA-DR- hematopoietic progenitor cells by sequential immunoadsorption (CEPRATE SC) and fluorescence-activated cell sorting: implications for gene transduction and/or transplantation.

The purification of early hematopoietic progenitor cells for autologous transplantation is based on two rationales: (1) elimination of clonogenic tumor cells, and/or (2) gene transfer into indefinitely self-replicating hematopoietic stem cells. Primitive CD34+ stem cells can be separated from more mature stem cells, or probably from clonogenic tumor cells, by differences in HLA-DR surface antigen expression. The objective of this study was to establish a large-scale technique for purification of CD34+, DR- progenitor cells from a large volume marrow harvest. In five different experiments, CD34+ cells were purified to between 76% and 91% by avidin-biotin immunoadsorption (CEPRATE SC) as a first step. This was followed by fluorescence-activated cell sorting to separate DR+ and DR- cells, which resulted in the generation of between 1.75 and 11.3 x 10(5) CD34+, DR- cells. The purity of DR- cells increased from between 0.5% and 4.3% in the immuno-adsorbed fraction up to 99% in the DR- sorted fraction. As shown in a single experiment, the purity of CD34+, DR- cells immediately after thawing increased from 0.01% to 94.3% while losing 99% of those early progenitor cells during the multistep purification procedure. We were able to physically separate one CD34+, DR- cell from up to 8000 nucleated cells in the prepurified cell suspension. One million highly purified CD34+, DR- progenitor cells is potentially an adequate cell dose for autologous transplantation equivalent to what is contained in an unselected and functioning marrow autograft.

Antigens, CD↗
PubMed1994

Serial transplantation shows that early hematopoietic precursor cells are transduced by MDR-1 retroviral vector in a mouse gene therapy model.

The administration of high and repeated doses of chemotherapy has been hampered by the bone marrow toxicity imposed by these drugs. This obstacle can be circumvented by the introduction of chemotherapy resistance genes into the normal marrow cells, which are then transplanted back into the patient. To show that this approach can improve our ability to safely deliver high doses of chemotherapy, we used an animal model system to transplant bone marrow cells which have been transduced with a safety-modified retrovirus containing human multiple-drug resistance (MDR-1) cDNA into lethally irradiated mice. These studies produced mice whose bone marrow and peripheral blood displayed an increased level of MDR-1 expression and resistance to the myelotoxic side effects of Taxol. To determine whether sufficient numbers of early hematopoietic precursor cells were transduced with the MDR-1 retrovirus so that durable Taxol-resistant hematopoiesis would result, we serially transplanted the modified bone marrow cells into each of six successive cohorts of BALB/c mice. Taxol-resistant hematopoiesis with little or no myelosuppression was observed in all six of the cohorts. These data suggest that very early precursor cells were transduced by the vector. This animal model may be of use in the development of genetic therapy programs which use bone marrow to introduce therapeutic molecules into the systemic circulation, since it permits in vivo selection of genetically modified hematopoietic progenitor cells. Furthermore, the retroviral vector system we have used could have an immediate impact in the clinical setting, where it can protect patients from the myelosuppressive side effects of Taxol in advanced stages of human epithelial cancers.

ATP Binding Cassette Transporter, Subfamily B, Mem↗
PubMed1994

The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function.

Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.

Animals↗
PubMed1994

High doses of cyclophosphamide, etoposide and total body irradiation followed by autologous stem cell transplantation in the management of patients with chronic myelogenous leukemia.

Eighteen patients with chronic myelogenous leukemia (CML) in chronic (9 patients) or advanced phases (9 patients) underwent autologous bone marrow transplantation (BMT) with a preparative regimen using high doses of cyclophosphamide, etoposide and total body irradiation (CY-VP16-TBI): cyclophosphamide 60 mg/kg daily on days 1 and 2; VP16 250 mg/m2 twice daily on days 1-3 and TBI 1020 cGy in six fractionated doses on days 5-7. Autologous marrow cells were reinfused on day 8. Three of the 8 patients in late chronic phase Philadelphia (Ph) chromosome-positive CML (37%) achieved a cytogenetic response, with Ph suppression to 25%, 29% and 44% Ph-positive metaphases, respectively, and lasting for 11, 1 and 3 months, respectively. The median duration of chronic phase following BMT was 26+ months (range 2-33+ months). One patient with Ph-negative, BCR-rearranged, chronic phase CML had a decrease of the BCR-rearranged band to 10% of pretreatment levels, which persisted for 6 months. None of the 9 patients with advanced CML phases (5 in second chronic, 1 in blastic, 3 in accelerated) achieved meaningful cytogenetic responses. Their median survival was 7 months from the time of BMT. Toxicities were mostly related to myelosuppression, particularly thrombocytopenia. Febrile episodes developed in 16 patients (89%). Treatment-related deaths occurred in 2 patients (11%). In summary, autologous BMT using a TBI-containing regimen had acceptable toxicity. Future investigations will evaluate the additional benefit of purged autologous stem cell transplantation in patients with chronic phase CML.

Adolescent↗
PubMed1994

A phase I-II study of high-dose thiotepa, busulfan and cyclophosphamide as a preparative regimen for allogeneic marrow transplantation.

Thirty adults with hematologic malignancies at high-risk for relapse were treated on a phase I-II study of high-dose thiotepa, busulfan (BU) and cyclophosphamide (CY) as the preparative regimen for allogeneic marrow transplantation. Cyclosporine and methylprednisolone or anti-CD5 ricin A chain immunoconjugate were used as graft-versus-host disease prophylaxis. Filgrastim was given from day 1 to enhance engraftment. Median follow-up time is 16 months (range 9-29 months). Grades III-IV regimen-related toxicity occurred in 5 (26%) of 19 patients treated with thiotepa 250 mg/m2 x 3, BU 1 mg/kg x 12 and CY 60 mg/kg x 2 and this was considered the maximal tolerated dose-schedule. Stomatitis and hepatoxicity were dose-limiting. All patients engrafted and had complete donor chimerism. The actuarial rate of acute graft-versus-host disease was 71% (95% CI 62-80%). The relapse rate at 1 year was 38% (95% CI 25-50%) and the actuarial survival at 1 year was 30% (95% CI 22-38%). The combination of thiotepa, BU and CY is tolerable as a preparative regimen for allogeneic marrow transplantation.

Adolescent↗
PubMed1994

Acanthamoeba meningoencephalitis after bone marrow transplantation.

Two patients presented with fever and nodular pulmonary infiltrates 9 and 6 months after marrow transplantation for leukemia. The second patient also had painful subcutaneous nodules that subsequently ulcerated. Both had a history of sinusitis and both had recently been treated with corticosteroids. During treatment with antibacterial and antifungal antibiotics, they developed rapid mental deterioration, coma and/or seizures. CT findings included hydrocephalus with extensive cortical and periventricular hypodensities in the first patient, and hydrocephalus with a cerebellar hemorrhage and edema in the second patient. Cerebrospinal fluid had a low glucose and elevated protein levels with few erythrocytes and little or no pleocytosis. Despite therapy with broad-spectrum antibiotics, including coverage for opportunistic infections, both patients died. Autopsy revealed Acanthamoeba species causing necrotizing meningoencephalitis, pneumonitis and adrenalitis in the first patient and causing necrotizing meningoencephalitis and dermatitis in the second patient. While these are the only reported cases of disseminated Acanthamoeba infection in marrow transplant recipients, a review of the literature suggests that this organism may be a new cause of opportunistic infections.

Acanthamoeba↗
PubMed1994

Ganciclovir three times per week is not adequate to prevent cytomegalovirus reactivation after T cell-depleted marrow transplantation.

To determine if ganciclovir given three times per week post-transplant is tolerable and effective for prevention of cytomegalovirus (CMV) infection in recipients of T cell-depleted marrow from related or unrelated donors, we have used ganciclovir 2.5 mg/kg iv three times daily on days -8 to -2 and 5 or 6 mg/kg iv 3 times per week from engraftment to day 100 as CMV prophylaxis for 51 adults who were CMV-seropositive or had seropositive donors. All patients received iv immunoglobulin 500 mg/kg weekly and CMV-negative or filtered blood products. Blood and urine were tested for CMV at weekly intervals through day 100. All patients received ganciclovir pre-transplant. Ten patients did not receive ganciclovir post-transplant (5 deaths, 3 graft failure, 1 renal failure, 1 required foscarnet). The median time to initiation of ganciclovir was 27 days (range 17-59 days) and the median duration of therapy was 51 days (range 5-83 range). Twelve patients had dose reductions (3 neutropenia and 9 renal insufficiency). Seven patients died before day 100, 2 had indications to change to foscarnet, 15 discontinued ganciclovir because of neutropenia and 17 completed the full ganciclovir course through day 100. G- or GM-CSF was given to 29 patients with neutrophils < 1.5 x 10(9)/l (10 had neutrophils < 0.5 x 10(9)/l) but only 12 of them could continue full-dose ganciclovir. Bacteremia occurred in 12 of the neutropenic patients. At day 120, the actuarial rate of CMV infection was 58% (95% CI 42-74%) and that of CMV disease was 36% (95% CI 21-51%).(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗
PubMed1994

The requirement of the carboxyl terminus of p53 for DNA binding and transcriptional activation depends on the specific p53 binding DNA element.

The p53 protein specifically binds DNA sequences and activates transcription. In this study, we investigated the requirement of the carboxyl (C)- or amino (N)-terminal domain of p53 for the binding and transactivation of two DNA elements, p53CON and the ribosomal gene cluster (RGC). Three human p53 mutants with deletion in either the C-terminus or N-terminus were used. Mobility-shift assays showed that the oligomerization-defective mutant p53(1-326), from which the final 67 C-terminal amino acids were deleted, retained the wild-type p53's ability to bind the p53CON element in the presence of anti-p53 monoclonal antibody PAb1801. Also, the transient transfection assays showed that the mutant p53(1-326) activated p53CON-mediated transcription. However, this mutant failed to bind the RGC element and was unable to activate RGC-mediated transcription. Thus, the requirement of the C-terminal region of p53 for DNA binding and transcription activation varies with the p53-binding DNA element under study. In contrast, the N-terminus of p53 contains a common transcription activation domain: deletion of the 80 or 159 N-terminal amino acids inactivated both p53CON- and RGC-mediated transactivation. Furthermore, mobility-shift assays did not detect any binding to p53CON- and RGC by either of the two N-terminal-deletion mutants. These results suggest that the N-terminus of p53 affects DNA binding.

Base Sequence↗
PubMed1993

Current trends and future directions in the genetic therapy of human neoplastic disease.

All of these initiatives are exciting and may provide therapy that is not as destructive to normal tissues as most existing modalities of therapy, because the therapy is directed to particular molecular defects in the tumor cells. Possibly, this therapy can be individualized for the defects present within the cancer cell that result in disease. Such therapy could reduce treatment costs, because it will be less toxic and, therefore, more cost-effective. We are making the transition to therapy directed to molecular targets and specific for each patient. The potential rewards of this new direction are great in terms of improvement of the therapeutic outcome and reduction of toxicity and cost. Let us hope that the systematic study of these principles of therapy, which is now underway in many medical centers, will alter the unfavorable natural history that characterizes many of the most commonly encountered neoplastic diseases in humans.

Adenoviridae↗
PubMed1993

Interferon-gamma priming effects in the activation and deactivation of ISGF3 in K562 cells.

ISGF3 is a major protein factor which mediates the transcriptional activation of interferon-inducible genes. ISGF3 is composed of two subunits, ISGF3 gamma and ISGF3 alpha, which are stimulated by interferon-gamma (IFN-gamma) and interferon-alpha (IFN-alpha), respectively. In this paper, the effect of pretreatment of IFN-gamma on the response of K562 cells to IFN-alpha, termed "gamma-priming," is examined. Using techniques of gene transfection and mobility shift assay, we studied the gamma-priming effects on the kinetics of appearance and disappearance of (i) the protein product of a luciferase reporter gene driven by an IFN-inducible promoter and (ii) the binding of ISGF3 to the interferon-stimulated response element. We found that exposure of cells to IFN-gamma prior to IFN-alpha greatly increased both the levels and the rate of ISGF3 binding activity during the early phase of IFN-alpha treatment and caused the amount of ISGF3 bound to the interferon-stimulated response element to decrease more rapidly with time during the later phase. Such effects were reflected also on the kinetics of expression of the interferon-inducible luciferase gene induced by IFN-alpha. In order to understand the basis of these gamma-priming effects, we use an in vitro reconstitution method to examine the kinetics of the subcomponents of ISGF3 in response to different IFN treatments in K562 cells. It was found that gamma-priming not only increased the levels of ISGF3 gamma, but it also stimulated both the rates of rise and fall of the activated alpha-component of ISGF3. A molecular model is proposed to explain these findings.

Base Sequence↗
PubMed1993

Expression of unusual immunophenotype combinations in acute myelogenous leukemia.

Immunophenotypes for 272 patients with acute myelogenous leukemia (AML) were analyzed using a panel of 22 antibodies. Numerical evidence for unusual coexpressions (present in normal marrow at < or = 0.1%) of surface markers on > or = 10% of the blast cells was found in 85% of all cases. Asynchronous expression of myeloid differentiation antigens occurred in 70% of the cases. Unusual coexpression of T-lymphoid, B-lymphoid, or natural killer (NK) markers with myeloid markers occurred in 38%, 13%, and 21%, respectively, of all AML cases. Two- and three-color analyses confirmed coexpression in 15 of 15 cases, and indicated that these percentages are an underestimate, because coexpression can be demonstrated in cases without numerical overlap. These data indicate that the unusual coexpression of normal differentiation antigens is a common occurrence in AML. Markers in 12 of 13 patients were similar between presentation and relapse, and in two patients, unusual phenotypes detected at first relapse were shown at second relapse, indicating these immunophenotypes are stable in the majority of AML patients. Significant correlations were found between t(8;21) cytogenetics and coexpression of CD19 with CD15 or CD34, t(9;22) and coexpression of CD19 and CD34, and t(15;17) and coexpression of CD2 and myeloid antigens. Multiparameter fluorescence analysis allows detection of unusual phenotypes when the blast counts are < 5% (classical remission). Analysis of 16 patients in remission indicated the presence of presentation phenotypes in 0.2% to 7.9% of the lymphocyte + blast light scatter region, representing 0.03% to 1.4% of the total nucleated marrow cells. Of the 16 patients with > or = 4 months follow-up after detection of these cells, 6 of 6 patients with > or = 0.2% unusual presentation phenotypic marrow cells have relapsed, while 9 of 10 patients with < 0.2% remain in remission. The detection of cells with the unusual presentation phenotype may reflect residual AML cells, and their increase may predict relapse.

Adult↗
PubMed1993

Molecular approaches to the diagnosis and treatment of cancer.

We have used autologous bone marrow transplantation (ABMT) as a setting to develop the genetic therapy of cancer in hematopoietic neoplasms based on the use of the bone marrow as a conduit through which to introduce regulatory molecules into the patient. This has involved three developmental phases: 1) learning how to develop genetic modification techniques; 2) learning how to develop in vivo selection techniques for the genetically modified cells; and 3) developing molecular vectors for modification of hematopoietic cells for therapy of cancer. These programs will be summarized in terms of their progress at the conference.

Bone Marrow Transplantation↗