PubMed Health⌕ Search

Biomedical subjects

A Deisseroth

Publications and source records attributed to A Deisseroth.

At least 37 records · Page 2Linked to original sources
PubMed1994

Liposomal delivery of methylphosphonate antisense oligodeoxynucleotides in chronic myelogenous leukemia.

Chronic myelogenous leukemia (CML) is a hematologic malignancy characterized by the presence of the Philadelphia (Ph) chromosome. Bcr-abl, the fusion gene associated with the Ph chromosome, expresses a p210bcr-abl protein that promotes a selective expansion of mature myeloid progenitor cells. Methylphosphonate (MP) oligodeoxynucleotides complementary to specific regions of the bcr-abl mRNA were incorporated in liposomes. We studied the effects of liposomal MP (L-MP) on the growth inhibition of CML-like cell lines. L-MP targeted to the breakpoint junctions of the bcr-abl mRNA inhibited the growth of CML cells. Fifty percent inhibition was achieved at approximately 1 mumol/L of L-MP oligonucleotide concentrations. The inhibitory effect was selective because growth inhibition was observed only with CML but not with control cell lines. Moreover, CML cell growth inhibition was dependent on the sequence of the MP oligodeoxynucleotides incorporated in the liposomes. The growth inhibition of CML cells by L-MP resulted from selective inhibition of the expression of the p210bcr-abl protein.

Base Sequence↗
PubMed1994

Autologous transplants for chronic myelogenous leukaemia: results from eight transplant groups.

Chronic myelogenous leukaemia (CML) can be cured by donor marrow transplant. Unfortunately, suitably HLA-matched related or unrelated donors are not available for the majority of patients. Transplant of stem cells derived from a patient's own marrow or peripheral blood (autologous transplant) avoids the need for an HLA-matched donor, is associated with a less complicated and shorter hospital course than donor transplantation, and has been successful in the treatment of other haematological malignancies. We report results of autologous transplants in 200 patients with CML at eight marrow transplant centres over seven years. This is the first multicentre analysis of autologous transplants for CML and reports on the largest number of patients studied to date. We show that autologous transplants provide a plateau in the survival curve not observed in conventional treatments. Autologous transplants are associated with a high engraftment rate, low mortality, and prompt return of both younger and older patients to normal activity levels. Our results suggest that autologous transplants provide an alternative to conventional treatment in the care of patients not eligible for donor transplant.

Adolescent↗
PubMed1994

Biological characterization of stem cell present in mobilized peripheral blood of CML patients.

Peripheral blood stem cell grafts are now frequently used for autologous transplantation of patients with malignancies. In this report we address the question of whether true long-term repopulating pluripotent hematopoietic stem cells (PHSC) are mobilized into peripheral blood and whether stem cells isolated from CML patients are depleted of Philadelphia chromosome positive cells. The presence of stem cells in mobilized peripheral blood (MPB) was examined by staining the CD34+Lineage- (Lin-) population for the expression of the Thy-1 antigen. The extent and kinetics of mobilization of CD34+Thy-1+ Lin- cells into peripheral blood were studied. In our analysis the percentage of these cells was found to vary widely depending on the day of leukapheresis and the individual patient. Fluorescence activated cell sorting (FACS) was used to isolate Thy-1 subsets from MPB which were analyzed for activity in in vitro long term cultures and in two in vivo models in which SCID-hu mice were implanted with human fetal bone or thymus grafts. The long term culture assay shows that the cells which express Thy-1 are enriched for cobblestone area forming activity (CAFC), an assay which can be used as a measure of detecting PBSC's in vitro. This CD34+Thy-1+ Lin- cell population was capable of producing both B and myeloid cells, and maintaining CD34+Lin- cells in these long term cultures. Moreover, the CD34+Thy-1+Lin- cell subset possessed a higher ability to engraft and to produce multilineage hematopoietic lineages in the SCID-hu bone assay and T cells in the SCID-hu thymus assay.(ABSTRACT TRUNCATED AT 250 WORDS)

Antigens, CD↗
PubMed1993

Inactive p53 mutants may enhance the transcriptional activity of wild-type p53.

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.

Amino Acid Sequence↗
PubMed1993

Preliminary results of treatment with filgrastim for relapse of leukemia and myelodysplasia after allogeneic bone marrow transplantation.

BACKGROUND: Patients whose leukemia relapses after allogeneic bone marrow transplantation have a poor prognosis; few respond to further chemotherapy, and almost none survive over the long term. We present preliminary observations on the use of filgrastim (granulocyte colony-stimulating factor) for relapse after transplantation. METHODS: Seven female patients with leukemia (one with chronic myelogenous leukemia, five with acute myelogenous leukemia, and one with a myelodysplastic syndrome that transformed into acute myelogenous leukemia) whose disease relapsed within 360 days after allogeneic bone marrow transplantation received filgrastim (5 micrograms per kilogram of body weight per day by subcutaneous injection) to reinduce remission by stimulating residual donor marrow cells. Cytogenetic analysis of bone marrow, fluorescence in situ hybridization, and determination of restriction-fragment--length polymorphisms were used to assess response and chimerism. RESULTS: Three of the seven patients had a complete hematologic and cytogenetic remission, with reestablishment of hematopoiesis of donor origin. Mild chronic graft-versus-host disease developed in one patient, and acute graft-versus-host disease in none. One patient had a relapse 12 months after treatment, and two others remained in remission after 10 and 11 months. In two of the patients with a response, fluorescence in situ hybridization demonstrated stimulation of donor cells without differentiation of the leukemic clone. CONCLUSIONS: Filgrastim may be effective in selected cases of leukemic relapse after allogeneic bone marrow transplantation.

Adolescent↗
PubMed1992

Polymorphism at codon 72 of the p53 gene in human acute myelogenous leukemia.

A common polymorphism at codon 72 of the p53 gene in patients with acute myelogenous leukemia (AML) was analyzed by single-strand conformation polymorphism assay and sodium dodecyl sulfate polyacrylamide-gel electrophoresis of immunoprecipitated 35S-labeled P53 protein. No association between this polymorphism and a marked predisposition to AML was found. The half-lives of these two polymorphic forms of P53 were equivalent in normal phytohemagglutinin-stimulated lymphocytes, while the P53 Pro72 isoform was found to be twice as stable as the Arg72 isoform in Daudi cells.

Base Sequence↗
PubMed1992

An isoform of protein disulfide isomerase isolated from chronic myelogenous leukemia cells alters complex formation between nuclear proteins and regulatory regions of interferon-inducible genes.

We have previously shown that the electrophoretic mobility of complexes formed in vitro between nuclear proteins and the regulatory domains of interferon-inducible genes is altered by an extranuclear protein present in elevated levels in the myeloid cells of chronic myelogenous leukemia patients. Interferon-alpha reduces the level of this activity only in the cells of patients who are clinically sensitive to the antiproliferative effects of interferon-alpha. We have purified this protein to homogeneity and found it to be a 57-kDa protein which corresponds to an isoform of protein disulfide isomerase. Protein disulfide isomerase is an oxidoreductase which catalyzes the interconversion between the reduced and oxidized states of proteins which contain multiple sulfhydryl groups and disulfide bonds. These studies suggest that this protein may play an important role in the transcriptional activation of interferon-inducible genes, perhaps through redox mechanisms.

Base Sequence↗
PubMed1992

Prognostic value of proliferating cell nuclear antigen expression in chronic lymphoid leukemia.

Chronic lymphocytic leukemia (CLL) is a usually indolent disease that can assume an aggressive clinical course in some patients. To develop assays that would be predictive of how a particular patient's disease would evolve, we studied the expression of proliferating cell nuclear antigen (PCNA) by Western blotting in 40 patients with CLL. The concentration of PCNA, a cofactor for delta DNA-dependent DNA polymerase, is indicative of the proliferative state of the cell. Significantly lower PCNA levels were observed in earlier stage CLL when compared with more advanced disease. The leukemic cell proliferative rate, assessed by lymphocyte doubling time and flow cytometry, also correlated significantly with the level of PCNA expression. These results suggest that a high level of PCNA in the cells of CLL patients at presentation identifies a subgroup of patients whose CLL cells have a higher proliferative activity and who may, therefore, have a potentially shorter survival.

Actins↗
PubMed1992

Phase I trial of an interleukin-2 (IL-2) fusion toxin (DAB486IL-2) in hematologic malignancies expressing the IL-2 receptor.

DAB486IL-2 is a recombinant fusion toxin in which the native receptor binding domain of diphtheria toxin has been replaced with human interleukin-2 (IL-2). It selectively binds and intoxicates only cells that bear the high-affinity receptor for IL-2. In the first clinical trial of a genetically engineered ligand fusion-toxin, we have treated 18 patients with chemotherapy-resistant IL-2 receptor expressing hematologic malignancies with escalating doses of DAB486IL-2. The maximal tolerated dose of a daily intravenous bolus of DAB486IL-2 was 0.1 mg/kg per day for 10 doses, established by asymptomatic, reversible elevations of hepatic transaminases without changes in other tests of liver function. Other mild reversible side effects noted were rash, nausea, elevated creatinine, chest tightness, and fever. Pharmacokinetic analysis showed a monophasic clearance of 5.8 +/- 0.7 minutes with peak levels of 3,549 +/- 1,041 mg/mL at the 0.1 mg/kg dose. Approximately 50% of patients developed an antibody response to diphtheria toxin or DAB486IL-2. The presence of such antibodies did not preclude patients from experiencing an antitumor response as four of the six patients with antitumor effect had detectable antibody titers. Although this was a phase I trial designed to define the safety of DAB486IL-2, remissions were observed in three patients lasting from 5 to over 18 months. The ability to achieve significant tumor reductions in this group of heavily treated patients is encouraging and suggests additional trials are warranted in hematologic malignancies.

Adult↗
PubMed1992

Treatment of newly diagnosed acute myelogenous leukemia with granulocyte-macrophage colony-stimulating factor (GM-CSF) before and during continuous-infusion high-dose ara-C + daunorubicin: comparison to patients treated without GM-CSF.

We gave 56 patients with newly diagnosed acute myelogenous leukemia (AML) granulocyte-macrophage colony-stimulating factor (GM-CSF) 20 or 125 micrograms/m2 once daily subcutaneously before (for up to 8 days or until GM-CSF-related complications developed) and during, or only during (patients presenting with blast counts greater than 50,000 or other leukemia-related complications) ara-C (1.5 g/m2 daily x 4 by continuous infusion) and daunorubicin (45 mg/m2 daily x 3) chemotherapy. Because results seemed independent of GM-CSF schedule, we compared results in these 56 patients with results in 176 patients with newly diagnosed AML given the same dose and schedule of ara-C without GM-CSF (110 patients ara-C alone, 66 patients ara-C + amsacrine or mitoxantrone). Comparison involved fitting a logistic regression model predicting probability of complete remission (CR) and a Cox regression model to predict survival (most patients in all three studies were dead) with treatment included as a covariate in both analyses. After adjusting for other prognostically significant covariates [presence of an antecedent hematologic disorder, an Inv (16), t(8;21), or abnormalities of chromosomes 5 and/or 7, performance status, age, bilirubin], treatment with ara-C + daunorubicin + GM-CSF was predictive of both a lower CR rate and a lower survival probability. There were no treatment-covariate interactions, suggesting that the negative effect of this GM-CSF treatment regime was not an artifact of some imbalance in patient characteristics. The unadjusted Kaplan-Meier hazard rate of the ara-C + daunorubicin + GM-CSF group was not uniquely high during the initial 4 weeks after start of therapy, but was highest among the three treatment groups throughout weeks 5 to 16, suggesting that the negative effect of this treatment was not caused by acute toxicity. Patients who did not enter CR with this treatment tended to have persistent leukemia rather than prolonged marrow aplasia, suggesting that this treatment and, in particular, GM-CSF may increase resistance of myeloid leukemia cells to chemotherapy. To date, relapse rates are similar in all three groups (P = .43) (as are survival rates once patients are in CR) but much of the remission duration data is heavily censored, unlike the survival data. Our results suggest caution in the use of GM-CSF to sensitize myeloid leukemia cells to daunorubicin + ara-C chemotherapy.

Antineoplastic Combined Chemotherapy Protocols↗
PubMed1992

The phosphorylation of retinoblastoma gene product in human myeloid leukemia cells during the cell cycle.

Counterflow centrifugal elutriation and immunoblotting techniques were used to study the expression of the retinoblastoma (RB) gene during the cell cycle of BV173 chronic myeloid leukemia (CML) cells. Our data showed that Rb protein started to be phosphorylated at early G1 phase, became hyperphosphorylated when cells progressed to late G1 and S phases during cell cycle, and remained hyperphosphorylated throughout S and G2/M phases. Our data suggest that Rb phosphorylation starts at a more distal point to the G1/S phase boundary in human myeloid leukemia BV173 cells rather than at a point more proximal to the G1/S boundary, as seen in HeLa cells.

Cell Line↗
PubMed1992

Detection of minimal residual disease by polymerase chain reaction in Philadelphia chromosome-positive chronic myelogenous leukemia following interferon therapy.

The significance of the polymerase chain reaction (PCR) in the detection of minimal residual disease in Philadelphia chromosome (Ph')-positive chronic myelogenous leukemia (CML) following interferon therapy was investigated. Forty remission blood samples obtained at various remission time points from 29 patients in complete cytogenetic remission were analyzed. All 40 samples showed minimal residual Ph'-positive cells by PCR: 22 in remission for less than 12 months, 12 in remission for 12 to 24 months, four in remission for 25 to 60 months, and two in remission for more than 60 months. Of these 29 patients, seven relapsed at 4, 6, 9, 14, 17, 19, and 50 months after their first PCR-positivity during remission. One developed extramedullary myelopoiesis at 49 months after PCR-positivity. The remaining 21 patients remained in complete hematologic and cytogenetic remission with median follow-up of 13 months (range, 4 to 36 months) after PCR analysis. These findings indicate that PCR-positivity is not associated with immediate disease recurrence. Long-term follow-up is essential to determine the relevance of PCR-positivity, since late recurrence is observed in our study.

Biomarkers, Tumor↗
PubMed1992

Proliferation of hematopoietic cells is accompanied by suppressed expression of heat shock protein 70.

In this study, we have examined the synthesis of heat shock protein (HSP70) in leukemia cells from acute myelogenous leukemia (AML) patients and in mononuclear cells from normal individuals, before and after growth factor stimulation. We have shown that the HSP70 protein was expressed in these cells in the absence of temperature elevation. Stimulation of proliferation of AML cells by the growth factors interleukin-3 and granulocyte-macrophage colony-stimulating factor and stimulation of normal lymphocytes by phytohemagglutinin (PHA) resulted in decreased synthesis of HSP70, suggesting that high levels of HSP70 are associated with cellular differentiation.

Bone Marrow↗
PubMed1992

Identification of proteins binding to interferon-inducible transcriptional enhancers in hematopoietic cells.

The binding of nuclear proteins of hematopoietic cells to transcriptional enhancers of interferon-inducible genes has been studied before and after exposure to alpha-interferon. Mobility shift assays show that a complex formed with interferon-inducible transcriptional enhancers before interferon induction contains a 73- and 84-kDa protein. Amino acid sequencing of the oligoaffinity column purified 73- and 84-kDa proteins showed that they belonged to a family of DNA-binding proteins which have been previously identified to exhibit binding in a sequence nonspecific manner to the ends of fragmented DNA or the origin of replication of adenovirus Type 2 DNA and sequence-specific binding to the distal regions of the U1 small nuclear RNA promoter, the promoter of the transferrin receptor gene, and the transcriptional regulatory regions of HLA genes. Following exposure to alpha-interferon, more slowly migrating complexes appeared which contained a 48-kDa protein, a 95-kDa protein, and a 105-kDa protein which bound to the 9-27 transcriptional enhancer in a sequence-specific manner.

Affinity Labels↗