Biomedical subjects

A Douvas

Publications and source records attributed to A Douvas.

7 recordsLinked to original sources

PubMed1996

Neutralization of HIV type 1 infectivity by serum antibodies from a subset of autoimmune patients with mixed connective tissue disease.

Mixed connective tissue disease (MCTD) is a rheumatic disorder with clinical similarities to HIV-1 infection, and with characteristic autoimmune anti-RNP antibodies specific for the U1 snRNP splicing complex. Anti-RNP antibodies cross-react with the HIV-1 surface, owing to multiple homologies between the gp120/41 envelope complex and the 70K protein of U1 snRNP. A key epitope of 70K, its RNA-binding site, is homologous to a dominant B and T cell epitope in the third variable loop (V3) of gp120. In this study, we tested the ability of anti-RNP sera to inhibit HIV-1 infectivity in vitro. Of nine sera tested, five were 70-99% effective in neutralizing one or more HIV-1 strains. One serum was > 99% effective in neutralizing HIV-1MN, and 86 and 77% effective against the primary isolates HIV-1(CO) and HIV-1(JR-FL), respectively, an efficacy equal to that of a pool of broadly neutralizing antibodies from HIV-1-infected subjects (HIVIG). The mean neutralizing titer of anti-RNP sera against HIV-1(JR-FL) was 3.9-fold higher than that of HIVIG. Neutralizing potency was associated with high reactivity to gp120 by ELISA, and with the presence of serum rheumatoid factor, known to enhance antibody neutralization of other viruses. The current findings provide further evidence that individuals unexposed to HIV-1 may develop immunologic resistance by alternative mechanisms, possibly including molecular mimicry, or exposure to as yet unidentified retroviruses. Thus MCTD, which involves both B and T cell reactivity to self-epitopes homologous to HIV-1, may elucidate new strategies for generating protective immunity to this virus.

Antibodies, Antinuclear↗

PubMed1994

Cross-reactivity between autoimmune anti-U1 snRNP antibodies and neutralizing epitopes of HIV-1 gp120/41.

We report extensive amino acid sequence homology between HIV-1 gp120/41, and > 33% of a U1 RNA-associated splicing protein, 70K. The latter is a target of autoimmune anti-RNP antibodies in mixed connective tissue disease (MCTD). The homologies, involving dominant epitopes of 70K and neutralizing epitopes of gp120/41, are the basis for mutual antibody cross-reactivity. A key finding is that the epitope GRAFVTIG in the V3 loop of gp120 (strain IIIB) is homologous to the functionally essential U1 RNA-binding site of 70K. ELISA data reveal a mean reactivity of anti-RNP antibodies to V3 IIIB that is as high as that of HIV sera. V3 MN, containing the framework sequence G-AF-T, also cross-reacts with anti-RNP antibodies, as do hydrophilic epitopes in gp41 homologous to the COOH end of 70K. Further, there is strong cross-reactivity between HIV sera and 70K in Western blots. In contrast, antibodies from a related autoimmune disorder, Sjögren's syndrome (SS), are neither V3 nor gp41 selective. We conclude that the substantial cross-reactivities reported here are due to conserved, antigenically dominant B cell epitopes having homologous counterparts in 70K and gp120/41. Because antibody production in both MCTD and HIV-1 infection is T cell dependent, the results imply that common T cell clones are also activated in these two disease paradigms. Further exploration of the mechanisms that activate these clones, and that control their divergent fates in MCTD and AIDS, may provide new insights into immune dysregulation in HIV infection.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗

PubMed1993

A casein kinase type II (CKII)-like nuclear protein kinase associates with, phosphorylates, and activates topoisomerase I.

Topoisomerase I (Topo I) is involved in many cellular functions that involve unwinding of supercoiled DNA, such as transcription and replication. Topo I is also the target of autoimmune antibodies in progressive systemic sclerosis (scleroderma), and abnormal regulation of Topo I may influence the excessive production of collagen found in scleroderma. Topo I is phosphorylated in vivo at serine residues and, in vitro, the activity of Topo I is increased by phosphorylation by casein kinase type II (CKII) and protein kinase C (PKC). In this study, a protein kinase activity from rat liver nuclei is shown to copurify with Topo I during Bio-Rex 70 cation exchange chromatography. The kinase can phosphorylate Topo I at serine residues, resulting in a threefold increase in topoisomerase activity. A relatively tight association between this kinase and Topo I is demonstrated by the ability to coprecipitate the kinase with scleroderma autoimmune anti-Topo I antibodies. The kinase activity is similar to CKII since it is Ca2+ and cyclic nucleotide independent, it can utilize either ATP or GTP as phosphate donor, and it can phosphorylate casein and phosvitin, but not histones. However, unlike typical CKII, the Topo I-associated kinase could utilize Mn2+ almost as well as Mg2+, it is not stimulated by polyamines, and it does not appear to undergo autophosphorylation. In conclusion, we demonstrate that rat liver Topo I is relatively tightly associated with a CKII-like protein kinase that can phosphorylate and activate Topo I. These findings provide corroborative evidence that CKII, or a CKII-like protein kinase, is a physiologic regulator of Topo I.

Amino Acids↗

PubMed1991

Negative regulation of Scl-70/topoisomerase I by zinc and an endogenous macromolecule.

Scl-70/topoisomerase I (topo I), a target of autoantibodies in the human disorder scleroderma, may be linked to collagen overproduction. We report that physiologic concentrations of zinc (greater than or equal to 80 microM) potently inactivate human and rat topo I in the presence of a 125-fold molar excess of MgCl2. We also describe a highly acidic nuclear molecule which competitively inhibits topo I. 89kD complexes of topo I and inhibitor can be separated from active 70kD monomers by glycerol density gradient centrifugation. The complexes have a 20-fold higher Km for DNA than monomers. Dissociation by dilution results in a 50-fold increase in rat liver and a 47-fold increase in human fibroblast specific activity. Zinc inhibition is non-competitive, and independent of the endogenous inhibitor. Our studies suggest that the majority of topo I is normally maintained in an inactive state by physiologic inhibitors, and loss of negative regulation may have pathogenetic consequences.

Animals↗

PubMed1991

Multiple overlapping homologies between two rheumatoid antigens and immunosuppressive viruses.

Amino acid (aa) sequence homologies between viruses and autoimmune nuclear antigens are suggestive of viral involvement in disorders such as systemic lupus erythematosus (SLE) and scleroderma. We analyzed the frequency of exact homologies of greater than or equal to 5 aa between 61 viral proteins (19,827 aa), 8 nuclear antigens (3813 aa), and 41 control proteins (11,743 aa). Both pentamer and hexamer homologies between control proteins and viruses are unexpectedly abundant, with hexamer matches occurring in 1 of 3 control proteins (or once every 769 aa). However, 2 nuclear antigens, the SLE-associated 70-kDa antigen and the scleroderma-associated CENP-B protein, are highly unusual in containing multiple homologies to a group of synergizing immunosuppressive viruses. Two viruses, herpes simplex virus 1 (HSV-1) and human immunodeficiency virus 1 (HIV-1), contain sequences exactly duplicated at 15 sites in the 70-kDa antigen and at 10 sites in CENP-B protein. The immediate-early (IE) protein of HSV-1, which activates HIV-1 regulatory functions, contains three homologies to the 70-kDa antigen (two hexamers and a pentamer) and two to CENP-B (a hexamer and pentamer). There are four homologies (including a hexamer) common to the 70-kDa antigen and Epstein-Barr virus, and three homologies (including two hexamers) common to CENP-B and cytomegalovirus. The majority of homologies in both nuclear antigens are clustered in highly charged C-terminal domains containing epitopes for human autoantibodies. Furthermore, most homologies have a contiguous or overlapping distribution, thereby creating a high density of potential epitopes. In addition to the exact homologies tabulated, motifs of matching sequences are repeated frequently in these domains. Our analysis suggests that coexpression of heterologous viruses having common immunosuppressive functions may generate autoantibodies cross-reacting with certain nuclear proteins.

Amino Acid Sequence↗

PubMed1988

Does Sc1-70 modulate collagen production in systemic sclerosis?

Sc1-70, an autoantigen in systemic sclerosis, may accelerate collagen gene transcription by virtue of its activity as a topoisomerase I (topo I), a DNA template-modifying enzyme. A survey of sequences corresponding to all or part of the known topo I binding sequence AGAACTTAGAGAAAATTTAAA in four fibrillar collagen genes (three of them dermal) and sixteen non-collagen genes showed a striking preponderance of the tetramer 5'-CTTA-3', comprising the core of this binding sequence, at the exon-intron junctions of the fibrillar collagen genes (59% compared with 16% in the control group). In addition, a non-random clustering of three potential topo I binding sites was seen within 350 base-pairs of 5' flanking DNA in the dermal collagen gene alpha 2(I), and a fourth site occurred in the promoter region of the alpha 1(III) gene. The findings suggest that a selective vulnerability to the action of Sc1-70/topo I is built into the structure of the dermal collagen genes.

Amino Acid Sequence↗

PubMed1975

Some effects of calcium and magnesium ions on the activity of bovine pancreatic deoxyribonuclease A.

Bovine pancreatic deoxyribonuclease requires divalent metal cations for hydrolysis of DNA. The effects of calcium and magnesium, alone and combined, on the rate and kinetics of the reaction were examined. Divalent metal salts of DNA were used as substrates. The ratio of either Ca-2+ or Mg-2+ to DNA-P in these salts was 1:2. The Mg-2+ salt of DNA was found to have sufficient Mg-2+ for optimal DNAase activity. Addition of MgCl-2 to a large excess of Mg-2+ over DNA-P had no effect on the rate. Km for the hydrolysis of Mg-2+-DNA was 1.76 mM. Km for the hydrolysis of Ca-2+-DNA was too low to measure by our methods of assay, indicating a high affinity of enzyme for substrate. The rate of hydrolysis of Ca-2+-DNA, however, is slow compared to that of Mg-2+-DNA. By mixing the Ca-2+ and Mg-2+ salts of DNA, a synergistic effect on the activity of DNAase was observed. On the basis of kinetic studies the synergistic effect is attributed to an increased affinity of DNAase for DNA (Km equals 0.34 mM for the mixed Ca-2+, Mg-2+ salt of DNA). A 2-fold increase in DNAase activity was observed when DNAase was incubated in CaCl-2 before assay. This 2-fold stimulation was not related to the synergistic effect. DNAase I is inactive against the sodium salt of DNA. In experiments with mixed Na+ and Mg-2+ salts of DNA, Na+-DNA was found to be a competitive inhibitor of the action of DNAase against Mg-2+-DNA.

Animals↗