PubMed Health⌕ Search

Biomedical subjects

A Landy

Publications and source records attributed to A Landy.

At least 73 records · Page 4Linked to original sources

Structure and organization of the two tRNATyr gene clusters on the E. coli chromosome.

The structure and organization of the gene clusters coding for the two tyrosine-accepting tRNA species (tRNA1Tyr and tRNA2Tyr) on the E. coli chromosome have been determined. The mature structural sequences of the two tRNATyr genes, located on opposite sides of the E. coli chromosome, differ by only 2 bp, but sequences surrounding these portions of the genes are very different. The genes coding for tRNA1Tyr (tyrT) comprise two mature structural sequences separated by a 200 bp "intergenic spacer." It is known that in transducing phage, the region adjoining the CCA end of the second mature structural sequence comprises a 178 bp repeated sequence which contains an in vitro, rho-dependent transcriptional termination site. We find that these potentially genetically unstable repeated sequences are present in the E. coli chromosome with the same organization as that determined from transducing phage analyses. The gene that codes for tRNA2Tyr (tyrU) is present in a single copy and is tightly clustered with three other tRNA genes. One of these genes (to be called thrU) encodes a previously undescribed tRNA (to be called tRNA4Thr). The organization of this cluster on the E. coli chromosome is tRNA4Thr--8 bp--tRNA2Tyr--115 bp--tRNA2Gly--6 bp--tRNA3Thr. The importance of correlating structural analyses derived from specialized transducing phage with those determined for the chromosome itself is demonstrated by results which show that out of four independently isolated tRNATyr transducing phage, two carrying the tRNA1Tyr genes [phi80psu3+,- (Cambridge) and phi80sus2psu3+ (Kyoto)] and two carrying the tRNA2Tyr gene (lambdarifd 18 and lambdah80dglyTsu+36), only the first phage from each group has the same gene organization as that found in the E. coli chromosome.

Base Sequence↗

Interaction of int protein with specific sites on lambda att DNA.

We have studied the interaction of highly purified Int protein with DNA restriction fragments from the lambda phage attachment site (attP) region. Two different DNA sequences are protected by bound Int protein against partial digestion by either pancreatic DNAase or neocarzinostatin. One Int binding site includes the 15 bp common core sequence (the crossover region for site-specific recombination) plus several bases of sequence adjoining the core in both the P and P' arms. The second Int-protected site occurs 70 bp to the right of the common core in the P' arm, just at the distal end of the sequence encoding Int protein. The two Int binding sites are of comparable size, 30-35 bp, but do not share any extensive sequence homology. The interaction of Int with the two sites is distinctly different, as defined by the observation that only the site in the P' arm and not the site at the common core region is protected by Int in the face of challenge by the polyanion heparin. Restriction fragments containing DNA from the bacterial attachment site (attB) region exhibit a different pattern of interaction with Int. In the absence of heparin, a smaller (15 bp) sequence, which includes the left half of the common core region and the common core-B arm juncture, is protected against nuclease digestion by Int protein. No sequences from this region are protected by Int in the presence of heparin.

Bacteriophage lambda↗

Promoter mutations in the transfer RNA gene tyrT of Escherichia coli.

The DNA sequences for nine independent promoter mutants of a tyrosine tRNA gene, tyrT of Escherichia coli, are reported. The nine mutations involve six transitions, two transversions, and one deletion. They are located at four different sites in the first 30 base pairs preceding the start point of transcription. The changes found are: a T.A to A.T transversion at position -8 (two mutants); a T.A to C.G transition at position -8 (three mutants); a T.A to C.G transition at position -13 (two mutants); a T.A to C.G transition at position -16 (one mutant); and a deletion of a G.C base pair at position -26/27 (one mutant). Four of the five different mutant tyrT promoters have alterations at positions that might have been expected from DNA sequence studies with other prokaryote promoters. One of these mutants (a G.C deletion at position -26/27) occurs in a stretch of eight consecutive G.C base pairs which may be characteristic of stable RNA promoters.

Base Sequence↗

Structural analysis of the tRNA1Tyr gene of Escherichia coli. A 178 base pair sequence that is repeated 3.14 times.

The distal region of the tRNA1Tyr gene has been sequenced and found to have an unusual structure. It consists of a 178 base pair sequence that is repeated 3.14 times. The first repeat unit commences 19 base pairs before the end of the sequences encoding the mature tRNA, and these 19 base pairs are repeated faithfully at the beginning of each repeat unit. In the last fractional unit the repeated sequence extends only six base pairs beyond this 19 base pair sequence. Sequence information extends for 62 base pairs beyond the 3.14 repeating units, and no resemblance to the repeating sequence, or any other region of the tRNA1Tyr gene, is found. There are only 14 sites at which one of the repeats differs from the others; 11 of these are transitions, and the rest are transversions. The evolutionary implications of the differences are discussed. One of the differences, which occurs in the second repeat unit, corresponds to the location of the in vitro p-dependent transcription termination site. This is discussed along with other implications of the repeated structure.

Base Sequence↗

A rho-dependent termination site in the gene coding for tyrosine tRNA su3 of Escherichia coli.

A set of partially overlapping DNA restriction fragments that support promoter-dependent transcription of the tRNATyr1 gene of Escherichia coli has been used to study site-specific termination in vitro. Transcription termination occurs at a specific site 224-226 nucleotides beyond the end of the structural gene and is completely dependent on rho-factor. Certain features of this site suggest differences from other termination sites previously studied. A role for specific sequence recognition is suggested.

Base Sequence↗

Structure of the lambda att sites generated by int-dependent deletions.

Bacteriophage lambda integrates into the chromosome of its Escherichia coli host by means of a site-specific recombination between a locus on the phage chromosome (phage att site) and a locus on the bacterial chromosome (bacterial att site). The nucleotide sequence of four lambda att sites altered in site-specific recombination has been determined. The int-dependent deletions that generated these att sites have one end point within the phage att site and extend either to the left or to the right. As a result of the new internucleotide bond created by deletion formation, these phage have alterations in the 15-base-pair common core region. The new DNA sequences brought to the att sites by the deletions, designated delta for regions to the left and delta' for regions to the right, do not share any discernible homology with their analogous counterparts in the phage att site arms, P and P', respectively, or with the bacterial att site arms, B and B', respectively. The finding of alterations in the 15-base-pair common core region necessitates a reinterpretation of the genetic properties of these att sites in site-specific recombination. The structure of these sites in relation to their genetic properties can be viewed as being consistent with a model in which the only specificity elements in int-dependent site-specific recombination are the common core region, O, and the phage arms, P and P'.

Base Sequence↗

HindII, HindIII, and HpaI restriction fragment maps of bacteriophage lambda DNA.

The site-specific restriction endonucleases isolated from Hemophilus influenzae strains Rc (HincII) and Rd (HindII + III), and Hemophilus parainfluenzae (HpaI) were used to digest bacteriophage lambda DNA into 34, 40, and 15 specific fragments, respectively. The sites cleaved by each of these enzymes were localized on the lambda physical map and the fragments resulting from these cleavages were electrophoretically identified on gels by (1) analysis of the digestion profiles of deletion and transducing derivatives of lambda; and (2) digesting individual fragments produced by one restriction endonuclease with another restriction endonuclease. This paper presents the HindII, HindIII, and HpaI restriction fragment maps for the entire lambda genome, and the data used to derive these maps for the region of the lambda genome between the attachment site (at 57.3% lambda) and the right vegetative end (100% lambda). The data for mapping the left arm of lambda may be found in the accompanying paper (Robinson and Landy, 1977).

Chromosome Mapping↗

HindII, HindIII, and HpaI restriction fragment maps of the left arm of bacteriophage lambda DNA.

The sites on the left arm of bacteriophage lambda DNA cleaved by the restriction endonucleases isolated from Hemophilus influenzae strain Rc (HincII) and Rd (HindII + III), and Hemophilus parainfluenzae (HpaI) were localized on the lambda physical map, and the fragments resulting from these cleavages were identified by gel electrophoresis. The restriction sites within the b2 region of lambda were mapped by analysis of the digestion profiles of deletion and substitution derivatives of lambda, as well as by digesting individual fragments produced by one restriction endonuclease with another restriction endonuclease. The restriction sites of the lambda genome between the left vegetative end and the b2 region were mapped entirely by succesive digestion experiments. The restriction fragment map for the right arm of lambda may be found in the accompanying paper (Robinson and Landy, 1977).

Chromosome Mapping↗

Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends.

The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides.

Base Sequence↗

Preparative fractionation of DNA restriction fragments by high pressure column chromatography on RPC-5.

High pressure liquid chromatography on the RPC-5 reversed-phase ion exchange system has been shown to have several potential applications as an initial high capacity step in the isolation of specific DNA restriction fragments. The fractionation of the Hinc II digest of lambda DNA, which contains 35 fragments with "flush ends" ranging in size from 3 x 10(6) to 7 x 10(4) daltons, has been used as a model system. Under certain conditions there are some restriction fragments whose elution relative to other fragments is different on RPC-5 chromatography than it is on gel electrophoresis. In some special circumstances it is possible to obtain satisfactory yields (60-70%) of a pure restriction fragment after a single passage through an RPC-5 column.

Chromatography, Ion Exchange↗