Biomedical subjects

A Nishikawa

Publications and source records attributed to A Nishikawa.

At least 19 recordsLinked to original sources

PubMed2006

Percutaneous application of peptidoglycan from Staphylococcus aureus induces mast cell development in mouse spleen.

BACKGROUND: Previously, we found that percutaneous application of peptidoglycan (PEG) from Staphylococcus aureus increased the number of mast cells in the dermis, as seen in patients with atopic dermatitis. However, the origin of the mast cells infiltrating the dermis was not known. Our aim was to determine the origin of the skin mast cells induced by the percutaneous PEG application in mice. METHODS: PEG was applied to barrier-disrupted abdominal skin of mice every 5 days. Twenty days after the first application, mast cells were detected in the spleen cells by alcian blue-safranin staining. Expression of mast cell proteases and cytokines in the skin or spleen was investigated by reverse transcription-polymerase chain reaction. RESULTS: Percutaneous application of PEG increased the numbers of alcian blue-positive and safranin-negative mast cells in the spleen. Reverse transcription-polymerase chain reaction analysis of the spleen showed that these mast cells expressed mouse mast cell protease (MMCP)-1, MMCP-4, MMCP-5, and mast cell carboxypeptidase, suggesting that they were immature cells positioned developmentally between mucosal mast cells and connective tissue mast cells. In vitro long-term culture of spleen cells in the presence of PEG induced mast cell development. The features of these mast cells were coincident with those seen in the spleens of PEG-applied mice. Furthermore, when mice were intradermally injected, their skin showed increased levels of expression of mRNAs of MMCP-4, MMCP-5, and mast cell carboxypeptidase, but not MMCP-1. Similar mRNA expression was observed in the skin of PEG-applied mice. CONCLUSIONS: Percutaneous application of PEG may lead to the development of mast cells in the spleens of mice and contribute to an increase in mast cell numbers in the dermis, as seen in the skin lesions of atopic dermatitis patients.

Administration, Cutaneous↗

PubMed2006

cDNA cloning and functional characterization of Xenopus laevis DNase gamma.

We report here the cDNA cloning and functional analysis of Xenopus DNase gamma (xDNase gamma). Two forms of cDNAs are isolated from adult spleen: one composing a 933 bp open reading frame for the enzymatically active xDNase gamma protein, and the other encoding an inactive short alternative form. Northern blot analysis revealed that the xDNase gamma mRNA is expressed in spleen, liver, testis, and ovary. xDNase gamma expression is scarcely detected in the tail muscle of tadpoles; however, it increases during metamorphosis and reaches a maximum during the late metamorphic climax. The ectopic expression of xDNase gamma results in the appearance of extensive DNA fragmentation in C2C12 myoblasts after the induction of apoptosis. In contrast, Xenopus DNase I fails to induce apoptotic DNA ladder formation under the same conditions. Our results suggest a possible involvement of xDNase gamma in apoptosis during amphibian metamorphosis.

Alternative Splicing↗

PubMed2005

Lack of chemopreventive effects of alpha-eleostearic acid on 7,12-dimethylbenz[a]anthracene (DMBA) and 1,2-dimethylhydrazine (DMH)-induced mammary and colon carcinogenesis in female Sprague-Dawley rats.

alpha-Eleostearic acid is one of the conjugated linolenic acids from tung oil, which is obtained from the seeds of Aleurites fordii. The effects of dietary alpha-eleostearic acid (18:3, n-5) on the post-initiation period of 7,12-dimethylbenz[a]anthracene (DMBA) and 1,2-dimethylhydrazine (DMH)-induced mammary and colon carcinogenesis were examined using female Sprague-Dawley (SD) rats. For initiation, rats were given subcutaneous injections of 40mg/kg body weight (5 times) and 20mg/kg body weight (3 times) of DMH during the age of 6-8 weeks and a single intragastric administration of 50mg/kg body weight of DMBA at 9 weeks. Then, the animals were treated with 0%, 0.01%, 0.1% or 1.0% alpha-eleostearic acid for 34 weeks. Control rats received the basal diet alone or 1.0% alpha-eleostearic acid without prior initiation treatment. All surviving animals were killed at week 37 of the experiment. There were no statistically significant alterations in any of the parameters for either mammary or colon tumors. These results thus indicate that alpha-eleostearic acid does not exert clear modification effects on DMBA and DMH-induced mammary and colon carcinogenesis, at least under the present experimental conditions.

1,2-Dimethylhydrazine↗

PubMed2005

A subchronic toxicity study of dunaliella carotene in F344 rats.

Dunaliella carotene, extracted from dunaliella alga (Dunaliella bardawil or Dunaliella salina), for use as a food-coloring agent, has beta-carotene as its mainly constituent. As there have been no reports of toxicological evaluation, a 90-day subchronic toxicity study was here performed in F344 rats at dose levels of 0 (control), 0.63%, 1.25%, 2.5% and 5% in powdered basal diet. The average daily intakes of dunaliella carotene were 352, 696, 1420 and 2750 mg/kg/day, respectively, for males, and 370, 748, 1444 and 2879 mg/kg/day for females. No mortality or treatment-related clinical signs were observed throughout the experimental period in any of the groups. Body weight gain was slightly but significantly (p < 0.05) reduced from week 5 to the end of the experiment in 2.5% and 5% males. Increased PLT were observed in 1.25% and 5% males, and 2.5% and 5% females. Significant elevations or tendencies for increase in serum T. Cho and Ca were observed in all treated males and females, with clear dose-dependence in males. Organ weight measurement and histopathological observation revealed no toxicological changes. Based on growth suppression, no-observed-adverse-effect-levels (NOAELs) were estimated to be 1.25% (696 mg/kg/day) for males and 5% (2879 mg/kg/day) for females. As increases in serum Ca were observed in the lowest group in both sexes, a no-observed-effect level (NOEL) could not be determined in this study.

Administration, Oral↗

PubMed2005

Lack of subchronic toxicity of an aqueous extract of Agaricus blazei Murrill in F344 rats.

Agaricus blazei Murrill, an edible mushroom, is widely used as a functional food due to its possible medicinal effects. Aqueous extracts are also used as food additive to provide an agreeable bitter taste. As a part of its safety assessment, the present 90-day subchronic toxicity study was performed in F344 rats. To establish a no-observed-adverse-effect level (NOAEL), rats were fed powder diet containing A. blazei Murrill aqueous extract at dose levels of 0 (basal diet), 0.63, 1.25, 2.5 and 5% (maximum) for 90 days. During the experiment, there were no remarkable changes in general appearance and no deaths occurred in any experimental group. Although serum blood urea nitrogen was slightly but significantly increased in males of the 2.5 and 5% groups, no related histopathological changes were observed in the kidney, and serum creatinine levels were rather reduced, suggesting the increase of blood urea nitrogen to be of little toxicological significance. Hematology, organ weight measurement and histopathological observation revealed no test compound-related toxicological changes. In conclusion, A. blazei Murrill extract even at 5% in the diet (2654 mg/kgb.w./day for male rats and 2965 mg/kgb.w./day for female rats) did not cause remarkable adverse effects in F344 rats. Thus, the NOAEL was concluded to be 5% in the diet.

Agaricus↗

PubMed2005

Lack of carcinogenicity of D-xylose given in the diet to F344 rats for two years.

The two year carcinogenicity of D-xylose was examined in groups of 50 male and 50 female F344 rats at dietary doses of 0% (control), 2.5% and 5%. The doses were selected on the basis of results from a 13-week subchronic toxicity study. Growth suppression and soft feces were observed in male and female rats of the 5% group. However, no significant differences from the controls were noted with regard to clinical signs, mortality and hematological findings. Decrease in absolute weight and increase in relative weight of the brain in males, and decrease of absolute kidney weight in females were observed in the 5% group, but there were no remarkable histopathological changes. A variety of tumors developed in all groups, including the controls, but all were histologically similar to those known to occur spontaneously in F344 rats, and no statistically significant increase in the incidence of any type of neoplastic lesion was found for either sex in the treated groups. Thus, it was concluded that, under the present experimental conditions, D-xylose is not carcinogenic to F344 rats.

Animals↗

PubMed2005

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Animals↗

PubMed2005

Percutaneous application of peptidoglycan from Staphylococcus aureus induces an increase in mast cell numbers in the dermis of mice.

BACKGROUND: Atopic dermatitis (AD) is a chronic inflammatory skin disease with immunopathologic features that vary depending on the duration of the lesion. The dermis of lesional skin of AD patients shows an increased number of inflammatory cells such as mast cells, eosinophils and mononuclear cells and superficial Staphylococcus aureus colonization. OBJECTIVE: The purpose of this study was to determine the effects of peptidoglycan (PEG) from S. aureus on mast cell induction in murine skin. METHODS: PEG was applied to barrier-disrupted abdominal skin of mice every 5 days and the number of mast cells in the abdominal skin was counted 20 days after the first application. The cytokine response was investigated by RT-PCR and immunohistologic analysis. RESULTS: The number of mast cells in the skin of mice treated with PEG was increased significantly compared with that of mice given phosphate-buffered saline. In addition, application of PEG to the abdominal skin increased the expression of mRNA for transforming growth factor-beta(1) (TGF-beta(1)), which supports mast cell migration, but not that for IL-3 or stem cell factor, which support both mast cell proliferation and mast cell migration. Immunohistologic analysis demonstrated that levels of TGF-beta(1) transcripts corresponded with those of protein synthesis in the epidermis. TGF-beta(1) was found to be highly expressed in keratinocytes of the basal epidermis of PEG-treated skin. Furthermore, intraperitoneal injection of anti-TGF-beta(1) antibodies neutralized the induction of mast cells into the skin. CONCLUSION: These results suggest that PEG may have the ability to induce an increase in mast cell numbers in the skin through TGF-beta(1) production by epidermal keratinocytes. Skin inflammation might therefore be linked to colonization with S. aureus in AD patients.

Abdomen↗

PubMed2005

Reassessment of the in vitro synergistic effect of fluconazole with the non-steroidal anti-inflammatory agent ibuprofen against Candida albicans.

We reassessed the in vitro synergistic effect of fluconazole with the non-steroidal anti-inflammatory agent ibuprofen against the pathogenic yeast Candida albicans. No synergistic effect of fluconazole combined with ibuprofen was seen against fluconazole-susceptible strains, but a remarkable effect was seen against fluconazole-resistant strains (FIX index: 0.02-0.03). Furthermore, vigorous growth of the microorganism, the so-called 'Eagle effect', was observed at concentrations higher than the minimal inhibitory concentrations of ibuprofen and fluconazole. Our results suggest that the combination of ibuprofen and fluconazole should prove useful for treating infection caused by fluconazole-resistant C. albicans.

Anti-Inflammatory Agents, Non-Steroidal↗

PubMed2003

A subchronic toxicity study of shea nut color in Wistar rats.

Shea nut color, obtained from nuts of the shea tree (Butyrospermum parkii), is used as a food-coloring agent. Flavonoid pigments are considered to be the responsible constituents. As there have been no reports of toxicological evaluation, a 13-week subchronic toxicity study was performed in Wistar Hannover rats at dose levels of 0 (control), 0.07, 0.31, 1.25 and 5% in powdered basal diet. The average of daily shea nut color intake was 51.3, 226.1, 986.8 and 3775.5 mg/kg/day for males and 56.4, 272.9, 1166.7 and 4387.7 mg/kg/day for females, respectively. During the administration period, daily observation of clinical signs and weekly measurement of body weights and food consumption were performed. After the end of the treatment, hematology, serum biochemistry, organ weight and histopathological examinations were conducted. No significant toxicological changes were observed in any parameters in this study. Hence, the no adverse effect dose of shea nut color was estimated to be greater than 5.0% for both sexes (3775.5 mg/kg/day for males and 4387.7 mg/kg/day for females).

Animals↗

PubMed2003

Lipoteichoic acid from Staphylococcus aureus enhances allergen-specific immunoglobulin E production in mice.

BACKGROUND: Our previous study demonstrated that lipoteichoic acid (LTA) from Staphylococcus aureus induced T helper type 2 (Th2)-prone dermatitis resembling that seen in atopic dermatitis (AD) patients in mice sensitized percutaneously with an allergen. However, the effects of LTA on allergen-specific IgE production in such sensitized mice have not been elucidated. OBJECTIVE: The purpose of this study was to determine the effects of LTA from S. aureus on allergen-specific IgE production in mice sensitized percutaneously with a house dust mite antigen (MA). METHODS: Mice were sensitized with a single topical application of MA and/or LTA to barrier-disrupted abdominal skin. One to 5 weeks later, MA-specific IgE antibodies in sera from sensitized mice were detected by an enzyme-linked immunosorbent assay (ELISA). Expression of B7.1 (CD80), B7.2 (CD86) and CD40L molecules by CD40-positive (CD40+) and CD4-positive (CD4+) cells in the lymph nodes of sensitized mice were analysed by flow-cytometry (FACS). RESULTS: Simultaneous sensitization with MA and LTA increased IgE production 3 weeks later, significantly more than sensitization with MA alone. FACS analysis of CD40+ cells in the lymph nodes from sensitized mice showed that simultaneous sensitization with MA and LTA did not enhance CD80- or CD86-expression by antigen-presenting cells such as B lymphocytes and dendritic cells more than sensitization with MA alone. However, analysis of CD4+ cells in the lymph nodes showed that simultaneous sensitization with MA and LTA increased the number of CD40L-expressing Th cells more than sensitization with MA alone. CONCLUSION: These results suggest that LTA enhances allergen-specific IgE production by a mechanism associated with up-regulation of CD40L-expressing Th cells and this might explain the role of skin colonization with S. aureus in AD patients.

Allergens↗

PubMed2002

A chronic toxicity study of josamycin in F344 rats.

The chronic toxicity of josamycin was examined in Fischer 344 (F344) rats. Groups of 10 males and 10 females were given the test compound in the diet at concentrations of 0 (control), 0.02, 0.1, 0.5 or 2.5% for 52 weeks. Daily intake of josamycin was 0, 10, 50, 260 and 1310 mg/kg body weight in males and 0, 10, 60, 290 and 1460 mg/kg body weight in females, respectively. Body weight gain was significantly (P<0.05) reduced in the male 2.5% group but no noticeable changes were found in food intake. In hematological examination, the platelet count was significantly (P<0.01) lower in the male groups given 0.02% or more of josamycin and in the 2.5% female group as compared with the control group values in a dose-dependent manner. In serum biochemical examination, blood urea nitrogen was significantly (P<0.05 and P<0.01, respectively) higher in males given 0.5 and 2.5% and total bilirubin was significantly (P<0.05) higher in females receiving 2.5% as compared with those of the control group. No death occurred at any dose levels during the dosing period. At necropsy, with the exception of cecal enlargement in the groups given more than 0.1% josamysin and a significant (P<0.01) increase in the relative liver weight of females in the 2.5% group, no particular findings related to the administration were observed. Histopathologically, the incidence and severity of liver bile duct proliferation in female 2.5% group were significantly (P<0.01) greater than those of the control group. Other histological changes found in the treated and control groups were similar to the spontaneous lesions in this strain of rats in terms of the incidence and severity. Interestingly, the josamycin treatment reduced the development of altered liver cell foci in females in a dose-dependent manner. Thus, it is concluded that, under the present experimental conditions, josamycin induces bile duct proliferation in female F344 rats at a high dose of 1460 mg/kg body weight. Based on the decrease of platelet count found in males given 10 mg/kg body weight or more, the no-observed-adverse-effect level (NOAEL) was estimated to be less than 10 mg/kg body weight.

Animals↗

PubMed2002

Lipoteichoic acid from Staphylococcus aureus induces Th2-prone dermatitis in mice sensitized percutaneously with an allergen.

BACKGROUND: We found previously that lipoteichoic acid (LTA) from Staphylococcus aureus has the ability to induce Th2 cytokine production by peripheral blood mononuclear cells (PBMC) from patients with atopic dermatitis (AD). However, it is not known whether LTA can induce a Th2-dominant cytokine response in the skin of AD patients. OBJECTIVE: The purpose of this study was to determine the effects of LTA in mice sensitized percutaneously with a house dust mite antigen (MA) through barrier-disrupted skin, as an experimental animal model of AD. METHODS: Mice were sensitized with MA by a single topical application to barrier-disrupted abdominal skin. Seven days after the sensitization, the mice were challenged on the dorsal skin by LTA to elicit localized skin inflammation. The cytokine response in the dorsal skin was investigated by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistological analysis. The infiltration of inflammatory cells in the skin was also observed by histological staining. RESULTS: Injection of LTA into the dorsal skin of MA-sensitized mice, which show a Th2-dominant cytokine response against the homologous antigen, increased the expression of mRNA for IFN-gamma, IL-4 and IL-5, but not IL-2. Immunohistological analysis demonstrated that levels of IFN-gamma, IL-4 and IL-5 transcripts corresponded with those of protein synthesis. In addition, the dorsal skin of MA-sensitized mice challenged with LTA showed significantly increased numbers of neutrophils, eosinophils, mononuclear cells and mast cells compared with control mice challenged with LTA. CONCLUSION: These results suggest that LTA has the ability to induce localized Th2-prone dermatitis in an allergen-independent manner in the skin of AD patients and may explain the role of colonization with S. aureus in AD patients.

Allergens↗

PubMed2002

Spontaneous development of aberrant crypt foci in F344 rats.

Aberrant crypt foci (ACF) have been proposed as intermediate biomarkers for colon carcinogenesis on the basis of many rodent studies. Although molecular analyses have indicated that these lesions in experimental animals are related to early events in colon carcinogenesis, their preneoplastic nature has yet to be fully elucidated. In the present study, one hundred and thirty 19-week-old male Fischer 344 rats were examined. The biological characteristics of spontaneous ACF were analyzed histopathologically, immunohistochemically and with molecular biological techniques, and compared with colon tumors found in control groups used for carcinogenicity tests. The incidences of spontaneous ACF consisting of 1, 2, 3 and 4 or more crypts were respectively 27.7%, 32.5%, 16.8% and 22.8%. Most ACF were distributed in the lower middle and upper distal colon, and proximal colon ACF was rare. Likewise, ACF frequently (42.5%) developed in untreated animals, whereas the incidence of spontaneous colorectal tumors was extremely low (0.68%) in control male rats. In addition, spontaneous ACF did not show apparent proliferative activity or c-K-ras point mutations. Our results thus suggest that spontaneous ACF rarely progress to colon tumors although long-term sequential observation might be necessary to conclude the significance of ACF.

Adenocarcinoma↗

PubMed2001

Essential similarities between spontaneous and MeIQx-promoted aberrant crypt foci in the F344 rat colon.

Aberrant crypt foci (ACFs) in the Fischer 344 (F344) rat colon, of control or 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx)-treated groups, were compared morphologically, immunohistochemically, and at the molecular biological level in order to elucidate their biological characteristics. Male 3-week-old rats were fed a diet supplemented with or without MeIQx at doses of 100 ppm or less for 16 weeks. The incidence of ACFs was the highest (90%) in animals given 100 ppm MeIQx but that in untreated rats was also surprisingly high (57%). Nine ACFs from nine MeIQx-treated rats and ten ACFs from ten untreated control rats were selected for detailed examination for their large size. There were no morphological differences in macroscopic and microscopic features between MeIQx-promoted and spontaneous ACFs. There were also no differences in immunohistochemical labeling for proliferating cell nuclear antigen (PCNA) and p53 protein between these ACFs although in both cases labeling was higher than in normal crypts. Dot blot hybridization revealed no c-K-ras mutations in codon 12 except in one ACF (11.1%) developing in a rat treated with 100 ppm MeIQx, in which a GGT-->GAT single base substitution was detected. Our results thus suggest that in terms of morphology, cell proliferation, P53 expression and c-K-ras mutation, most ACFs found in rats given 100 ppm MeIQx are essentially identical to their spontaneous counterparts.

Animals↗

PubMed2001

The efficiency of N-linked glycosylation of bovine DNase I depends on the Asn-Xaa-Ser/Thr sequence and the tissue of origin.

Bovine DNase I contains two potential N-linked glycosylation sites with the sequences Asn(18)-Ala-Thr and Asn(106)-Asp-Ser. A previous report established that pancreatic DNase I has only one sugar chain at Asn(18) [Liao, Salnikow, Moore and Stein (1973) J. Biol. Chem. 248, 1489-1495]. We found, however, that bovine DNase I expressed in COS-1 cells was glycosylated about 70% at Asn(106) in addition to being completely glycosylated at Asn(18). Glycosylation of Asn(106) increased to 97% when Asp(107) was mutated to Glu or when Ser(108) was mutated to Thr. Mutation of Asp(107) to Trp had no effect, whereas a substitution with Pro at this position abolished glycosylation of Asn(106). Analysis of the state of glycosylation of DNase I purified from a variety of bovine tissues revealed that DNase I from spleen, submaxillary gland, lung and adrenal had two sugar chains, whereas enzyme from pancreas and kidney had only one sugar chain. These findings demonstrate a major difference in the ability of various tissues to utilize N-linked glycosylation signals that contain suboptimal residues in the second and third positions.

Amino Acid Sequence↗

PubMed2001

Structural studies of the antigen III cell wall polysaccharide of Trichosporon domesticum.

Cell wall and soluble polysaccharides that reacted with Trichosporon domesticum factor III serum were isolated from the type strain of T. domesticum. The fractions contained O-acetyl groups, which contributed to the serological reactivity. The antigenic structure was characterized by chromatographic and spectroscopic methods. The polysaccharide has an alpha-(1-->3)-D-mannan backbone with hetero-oligosaccharide side chains consisting of a 2-O-substituted beta-D-glucuronic acid residue bound to O-2 of the mannose residue, beta-D-xylopyranosyl residues located in the middle of the side chain, and a nonreducing terminal alpha-L-arabinopyranosyl residue bound to 0-4 of xylose. The mannan backbone is O-acetylated at O-6 of the mannose residues.

Acetylation↗

PubMed2001

A glycomic approach to the identification and characterization of glycoprotein function in cells transfected with glycosyltransferase genes.

The transfection of glycoprotein glycosyltransferase genes into cells leads to modification of both the structure and function of the glycoproteins and as a result, changes in glycome patterns. N-glycan branching enzymes hold some promise as a model system for the identification of glycome patterns. Both N-acetylglucosaminyltransferase III and alpha 1-6 fucosyltransferase are typical glycosyltransferases, which are involved in the branching of N-glycans. The resulting enzymatic products, bisecting N-GlcNAc and alpha 1-6 fucose residues, are no longer modified by other glycosyltransferases and it is a relatively simple task to identify their modification by means of lectins. In this review, the glycome patterns of glycosyltransferase gene transfectants and the non-transfectants were compared by two-dimensional gel electrophoresis and lectin staining, and the biological significance of the two genes are described. Analyses of glycome patterns by transfecting glycosyltransferase genes will lead to new fields of study in the area of postgenome research.

Animals↗