PubMed Health⌕ Search

Biomedical subjects

A Piccini

Publications and source records attributed to A Piccini.

At least 19 recordsLinked to original sources
PubMed2005

A novel presenilin 1 L166H mutation in a pseudo-sporadic case of early-onset Alzheimer's disease.

We report a 44-year-old woman presenting at 33 years with memory loss, followed by progressive dementia. Her family history was negative for dominant genetic disorders at high penetrance. Analysis of presenilin-1 gene revealed a missense mutation at codon 166, leading to the substitution from leucine to histidine. The mutation occurs in the third transmembrane domain of presenilin-1, at the position of two different mutations previously described, associated with an atypical phenotype. The present case has two implications: (1) mutations of presenilin-1 have to be searched also in apparently sporadic cases of dementia beginning in the third decade of life; (2) as yet unidentified factors, besides the gamma-secretase complex, influence the phenotype of presenilin-1 mutations.

Adult↗
PubMed2004

Plasma levels of amyloid beta-protein 42 are increased in women with mild cognitive impairment.

BACKGROUND: Accumulation in the brain of small aggregates of amyloid beta-protein 42 (Abeta42) is the major pathogenic event of Alzheimer disease (AD). In familial early-onset AD this event is likely the result of Abeta42 overproduction; in the most common sporadic late-onset form of the disease the mechanisms of Abeta42 accumulation are unknown. METHODS: To address this issue the authors analyzed plasma levels of Abeta42 in 88 elderly patients with amnestic mild cognitive impairment (MCI), chosen as paradigm of preclinical sporadic AD. RESULTS: The authors found a significant increase of Abeta42 plasma levels in women with MCI, in comparison to the affected men and 72 cognitively normal age-matched subjects. The levels were independent of variables in education, apolipoprotein E genotype, cholesterol, and creatinine plasma concentrations, as well as hemoglobin content. CONCLUSIONS: The elevation of Abeta42 plasma levels in women with MCI may represent a biologic explanation for the sex-dependent increased incidence of late-onset AD in women identified by epidemiologic studies.

Age of Onset↗
PubMed2003

[Educating patients about heart failure in community hospitals: it is possible...].

Prognosis for heart failure is linked to patient's compliance. Compliance is also dependent from patient education about his disease and treatment. Therapeutic education could be done in a community hospital but needs a lot of time. However, therapeutic education for heart failure patients becomes more and more essential in clinical practice and improves patient knowledge and implication and hospitalization duration.

Aged↗
PubMed2001

Transient oxygen-glucose deprivation induces rapid morphological changes in rat hippocampal dendrites.

Previous studies have revealed that pyramidal neurons in the CA1 region of the hippocampus are extremely susceptible to ischemia-induced cell damage and undergo selective degeneration 2-4 days after the insult. Little is known about early morphological changes in neurons occurring immediately after ischemic insult. Using two-photon laser scanning microscopy we monitored dendritic morphology of cells expressing enhanced green fluorescent protein in response to a transient hypoxic-ischemic episode in organotypic hippocampal slice preparations. This type of vital imaging provides direct evidence of dendritic rearrangements in rat CA1 pyramidal neurons occurring as soon as 20 min after oxygen-glucose deprivation. We propose that dendritic reorganization, resembling that occurring after tetanic stimulation, may be an early stage response to compensate the loss of synapses caused by ischemia-induced neuronal injury.

Animals↗
PubMed2000

Endogenous APP derivatives oppositely modulate apoptosis through an autocrine loop.

We have recently shown that, in rat cerebellar granule cells, apoptosis triggered by KCl deprivation is associated with an amyloidogenic shift in the processing of amyloid precursor protein (APP) resulting in an increase of amyloid beta-protein (A beta) secretion. To further investigate this issue we studied the relationship between secretion of APP metabolites (A beta, APPs) and neuronal degeneration. We postulated that the endogenous products of the APP metabolism may modulate neuronal survival by an autocrine loop. Treatment of cerebellar granule cells with various antibodies raised against different epitopes of APPs and A beta oppositely modulates low potassium apoptotic cell death. Antibodies specific for the N-terminal of A beta (4G8, 6E10, R3659) increased neuronal survival by 30% over controls. On the contrary, treatment of cultures undergoing apoptosis with the monoclonal antibody 22C11 directed against the APP N-terminus reduced neuronal survival by 53%, suggesting that endogenous alpha-APPs contribute to neuronal survival. Moreover low KCl culture medium, conditioned by cerebellar granule cells, attenuated the apoptotic process. This anti-apoptotic effect was abolished by removal of APPs from the conditioned medium. Western blotting of APPs removed from the conditioned medium confirmed the presence of alpha-APPs. These data indicate that APP cleavage products oppositely modulate neuronal survival through an autocrine loop and further strengthen an Alzheimer's disease pathogenetic scheme based on altered metabolism of APP.

Amyloid beta-Protein Precursor↗
PubMed2000

Driving AMPA receptors into synapses by LTP and CaMKII: requirement for GluR1 and PDZ domain interaction.

To elucidate mechanisms that control and execute activity-dependent synaptic plasticity, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate receptors (AMPA-Rs) with an electrophysiological tag were expressed in rat hippocampal neurons. Long-term potentiation (LTP) or increased activity of the calcium/calmodulin-dependent protein kinase II (CaMKII) induced delivery of tagged AMPA-Rs into synapses. This effect was not diminished by mutating the CaMKII phosphorylation site on the GluR1 AMPA-R subunit, but was blocked by mutating a predicted PDZ domain interaction site. These results show that LTP and CaMKII activity drive AMPA-Rs to synapses by a mechanism that requires the association between GluR1 and a PDZ domain protein.

Animals↗
PubMed1998

Opposite roles of apolipoprotein E in normal brains and in Alzheimer's disease.

We have characterized the interaction between apolipoprotein E (apoE) and amyloid beta peptide (Abeta) in the soluble fraction of the cerebral cortex of Alzheimer's disease (AD) and control subjects. Western blot analysis with specific antibodies identified in both groups a complex composed of the full-length apoE and Abeta peptides ending at residues 40 and 42. The apoE-Abeta soluble aggregate is less stable in AD brains than in controls, when treated with the anionic detergent SDS. The complex is present in significantly higher quantity in control than in AD brains, whereas in the insoluble fraction an inverse correlation has previously been reported. Moreover, in the AD subjects the Abeta bound to apoE is more sensitive to protease digestion than is the unbound Abeta. Taken together, our results indicate that in normal brains apoE efficiently binds and sequesters Abeta, preventing its aggregation. In AD, the impaired apoE-Abeta binding leads to the critical accumulation of Abeta, facilitating plaque formation.

Alzheimer Disease↗
PubMed1998

Increased amyloidogenic secretion in cerebellar granule cells undergoing apoptosis.

Some clues suggest that neuronal damage induces a secondary change of amyloid beta protein (Abeta) metabolism. We investigated this possibility by analyzing the secretion of Abeta and processing of its precursor protein (amyloid precursor protein, APP) in an in vitro model of neuronal apoptosis. Primary cultures of rat cerebellar granule neurons were metabolically labeled with [35S]methionine. Apoptosis was induced by shifting extracellular KCl concentration from 25 mM to 5 mM for 6 h. Control and apoptotic neurons were then subjected to depolarization-stimulated secretion. Constitutive and stimulated secretion media and cell lysates were immunoprecipitated with antibodies recognizing regions of Abeta, full-length APP, alpha- and beta-APP secreted forms. Immunoprecipitated proteins were separated by SDS/PAGE and quantitated with a PhosphorImager densitometer. Although intracellular full-length APP was not significantly changed after apoptosis, the monomeric and oligomeric forms of 4-kDa Abeta were 3-fold higher in depolarization-stimulated secretion compared with control neurons. Such increments were paralleled by a corresponding increase of the beta-APPs/alpha-APPs ratio in apoptotic secretion. Immunofluorescence studies performed with an antibody recognizing an epitope located in the Abeta sequence showed that the Abeta signal observed in the cytoplasm and in the Golgi apparatus of control neurons is uniformly redistributed in the condensed cytoplasm of apoptotic cells. These studies indicate that neuronal apoptosis is associated with a significant increase of metabolic products derived from beta-secretase cleavage and suggest that an overproduction of Abeta may be the consequence of neuronal damage from various causes.

Amyloid beta-Peptides↗
PubMed1997

Regulation of human papillomavirus type 16 DNA replication by E2, glucocorticoid hormone and epidermal growth factor.

The E1 and E2 proteins are the only human papillomavirus (HPV) proteins required for transient replication of plasmids containing the viral origin. The E2 gene products play key roles in both viral transcription and replication. In this study we have analysed in further detail the nature of the association between E1 and E2 using a series of E2 proteins mutated in conserved regions of the N-terminal domain. These proteins were tested for their ability to activate transcription and to stimulate viral DNA replication. Several of these mutants revealed that the two functions of E2 can be separated, and that they define three widely spaced regions of the N-terminal domain which are important for DNA replication, two of which retain E1-binding activity. This suggests that E2 may have a role in viral DNA replication other than simply localizing E1 to the origin of replication. Additional important elements for regulating viral gene expression have been shown to be glucocorticoid hormones and epidermal growth factor (EGF). We show here that they may also be involved in regulating viral DNA replication. Our studies show that the addition of glucocorticoid hormone significantly stimulates viral DNA replication. In contrast, addition of EGF results in modest repression of viral DNA replication. These results have important implications for the pathogenesis of HPV infection and suggest that the relative levels of E2, glucocorticoid hormone and EGF may significantly affect the outcome of an HPV infection.

Cell Line↗
PubMed1996

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.

DNA, Single-Stranded↗
PubMed1996

Aspecific membranous laryngitis after infectious mononucleosis.

Aspecific membranous laryngitis is an unusual but very serious complication of viral infections. Here, we report the uncommon finding of infectious mononucleosis characterized by aspecific membranous laryngitis with fever, dysphonia and severe dyspnea in a 12-year-old girl. Endoscopy showed mucopus and sloughed epithelium forming a pseudomembrane covering almost all the supraglottal region and a supraglottal swelling including the epiglottis and arytenoids. The importance of suspecting diphtheria, epiglottitis, viral or bacterial croup and laringo-tracheo-bronchitis and including them in the differential diagnosis is emphasized.

Anti-Bacterial Agents↗
PubMed1995

Mutations in the human papillomavirus type 16 E2 protein identify multiple regions of the protein involved in binding to E1.

Human papillomavirus type 16 (HPV-16) DNA replicates episomally and requires two virally expressed proteins, E1 and E2. The E1 protein has both helicase and ATPase activities and is absolutely required for viral DNA replication. The E2 protein is a potent transcriptional activator and greatly increases viral DNA replication by colocalizing E1 to the origin of replication. Recently, we characterized a region of the E2 protein essential for the binding to E1. In this study we have analysed in further detail the nature of the association between E1 and E2. Using an extensive set of E2 mutant proteins we have identified two widely separate regions of the E2 protein which are essential for binding to E1. Interestingly, two E2 mutants which fail to bind E1 also fail to activate gene expression, indicating the existence of multifunctional domains on the E2 protein. In addition, cotransfection of E1 with E2 significantly increases E2 transcriptional activity on an heterologous promoter.

Binding Sites↗
PubMed1995

Mutations in the human papillomavirus type 16 E2 protein identify a region of the protein involved in binding to E1 protein.

Papillomavirus DNA replication is primarily dependent upon two viral gene products, E1 and E2. Work with bovine papillomavirus has shown that the E2 protein can bind directly to the E1 protein and enhance the binding of E1 to the viral origin of replication. However, little is known about the mechanism of interaction between E1 and E2 proteins. In this study we have analysed in detail the association between human papillomavirus type 16 (HPV-16) E1 and E2 proteins. Using a purified glutathione S-transferase-HPV-16 E1 fusion protein from Escherichia coli and E2 proteins produced by in vitro transcription-translation, we have developed a rapid and simple method for investigating the association between E1 and E2 in vitro. The binding of E2 to E1 was found to be dependent on sequences in the N-terminal activation domain of the E2 protein. Truncated forms of E2, including a putative repressor form of E2 encoding the DNA binding domain, failed to associate with E1 in this assay. The region of E2 required for efficient binding to E1 was then localized using mutants in the activation domain of E2. These results demonstrated that only a short region of E2 was required for association with E1. This region of E2 was found to be highly conserved amongst all papillomaviruses, suggesting a conservation of E2 function and a common mechanism of interaction between these virally encoded proteins.

Binding Sites↗
PubMed1992

[Morphofunctional correlations in children with upper maxillary endognathia].

In this study 23 oral breathing children suffering from maxillary hypoplasia (endognathia associated with skeletal class II or III), selected for rapid maxillary expansion (RME) have been investigated by active anterior rhinometry. None of these patients presented O.R.L. pathologies during clinical examination except for some sporadic cases of adenoid hypertrophy (5 cases). Rhinomanometric and cephalometric examinations carried out before and after RME treatment showed a good correlation between the nasal respiratory function parameters and the structural cephalometric elements investigated by means of teleradiography. In particular, an important reduction in nasal respiratory resistance in all patients with conversion from oral to nasal respiration in the majority of cases corresponds, together with cross-bite resolution, to increased transversal dimension of the maxilla produced by RME. A clear regression in adenoid hypertrophy, where present, is also noted without any type of O.R.L. treatment. The improved respiratory situation could therefore produce benefits on the trophism of the nasal mucous and the lymphatic rhinopharyngeal tissue. Agreement between clinical, radiological and rhinomanometric findings confirm the usefulness of this method in diagnosing and following-up patients with this problem.

Adolescent↗
PubMed1990

[Otorhinological evaluations of patients undergoing rapid disjunction of the median palatine suture].

Seven young patients, who had been diagnosed to be oral breathers by an orthodontist, have been submitted to an ETN specialist examination, before and after the rapid expansion of the mid-palatal suture. Five of these patients had an actual reduction of nasal breathing capacity. Four patients presented a significant enlargement of the adenoids. One patient showed a transmission auditive deficiency. The ETN examination, two months after the maxillary expansion, has permitted to find out that all the patients who had an impaired nasal breathing before the maxillary expansion, had normalized their respiratory capacity. Moreover, those subjects who had enlarged adenoids, showed a normal adenoids volume in the second ETN examination. Finally also the patient with an auditive deficiency presented a normalization of this function at the second ETN examination.

Adenoids↗