Biomedical subjects

A R Blanch

Publications and source records attributed to A R Blanch.

At least 19 recordsLinked to original sources

PubMed2005

Characterization of Shiga toxin-producing Escherichia coli isolated from aquatic environments.

This study reports the phenotypic and genotypic characterization of 144 Shiga toxin-producing Escherichia coli (STEC) strains isolated from urban sewage and animal wastewaters using a Shiga toxin 2 gene variant (stx(2))-specific DNA colony hybridization method. All the strains were classified as E. coli and belonged to 34 different serotypes, some of which had not been previously reported to carry the stx(2) genes (O8:H31, O89:H19, O166:H21 and O181:H20). Five stx(2) subtypes (stx(2), stx(2c), stx(2d), stx(2e) and stx(2g)) were detected. The stx(2), stx(2c), stx(2d) and stx(2e) subtypes were present in urban sewage and stx(2e) was the only stx(2) subtype found in pig wastewater samples. The stx(2c) and stx(2g) were more associated with cattle wastewater. One strain was positive for the intimin gene (eae) and five strains of serotypes were positive for the adhesin encoded by the saa gene. A total of 41 different seropathotypes were found. On the basis of occurrence of virulence genes, most non-O157 STEC strains are assumed to be low-virulence serotypes.

Adhesins, Bacterial↗

PubMed2005

Combined use of an immunomagnetic separation method and immunoblotting for the enumeration and isolation of Escherichia coli O157 in wastewaters.

AIMS: The detection of Escherichia coli O157:H7 in environmental samples is a human concern. The high persistence of this serotype in the environment suggests that contaminated animal wastewater could act as a potential reservoir. Nevertheless, the high levels of background microflora and cell damage because of environmental stress hamper the isolation of this pathogen without using enrichment methods. This study develops a method for the detection of E. coli and investigates its prevalence in animal and human wastewaters. METHODS AND RESULTS: Incubation of the sample for 1 h 30 min at 37 degrees C in peptone water supplemented with vancomycin and cefsulodin, enhanced the recovery of bacteria whilst ensuring that no growth occurred. Subsequently, a combination of immunomagnetic separation, cefixime-tellurite-sorbitol MacConkey (CT-SMAC) plating and immunoblotting with specific O157 antibodies allowed the detection, enumeration and isolation of E. coli O157 strains in human, swine and cattle wastewaters, which presented values of 0.2, 0.4, and 1.0 log10 ml(-1) units, respectively. Some of the isolates carried genes coding for Shiga toxins, intimin and enterohemolysin. CONCLUSIONS: Escherichia coli O157 is commonly present in animal and human wastewaters. The developed method reduced the high rate of false positives reported for other technical approaches. SIGNIFICANCE AND IMPACT OF THE STUDY: The confirmation of serotype by specific immunomethods is necessary to prevent false-positive detection and incorrect enumeration.

Animal Husbandry↗

PubMed2004

The composition and persistence of faecal coliforms and enterococcal populations in sewage treatment plants.

AIMS: The changes in structure and composition of faecal coliforms and enterococcal populations in sewage from different treatment plants, and the elimination of vancomycin- and erythromycin-resistant enterococci (VRE and ERE, respectively) in these treatment plants was analysed to determine any selective reduction. METHODS AND RESULTS: Faecal coliforms, enterococci, VRE, ERE and spores of sulphite-reducing bacteria were enumerated using standard methods. Samples were enriched where necessary in order to isolate antibiotic resistant strains. The structure and composition of these bacterial populations were determined by biochemical fingerprinting and clustering analysis. High diversity and similarity indexes were detected among all the bacterial populations in raw and treated sewage, independently of their origin and the treatment processes employed. Antibiotic resistant strains were detected in all sewage tested and no selective reduction was observed. CONCLUSIONS: The faecal coliforms and enterococci populations did not differ in the sewage samples studied. The vancomycin and erythromycin resistances of the enterococcal populations were similar in the sewage samples. Resistance to both antibiotics persisted after the treatment process independently of raw sewage flow, faecal origin or size of the human population contributing to sewage. However, sewage of mixed origin (human and animal) presented a lower similarity index for the two bacterial populations compared with that of the other human sewage analysed. SIGNIFICANCE AND IMPACT OF THE STUDY: Although a significant reduction in bacterial populations was observed, the persistence of VRE and ERE strains in the same proportions in sewage suggests that there is no selective elimination of bacterial populations during the treatment processes. The ability of antibiotic resistance strains to survive sewage treatment systems should be considered in certain water reuse programmes.

Anti-Bacterial Agents↗

PubMed2004

Multiplex PCR with 16S rRNA gene-targeted primers of bifidobacterium spp. to identify sources of fecal pollution.

Bifidobacteria are one of the most common bacterial types found in the intestines of humans and other animals and may be used as indicators of human fecal pollution. The presence of nine human-related Bifidobacterium species was analyzed in human and animal wastewater samples of different origins by using species-specific primers based on 16S rRNA sequences. Only B. adolescentis and B. dentium were found exclusively in human sewage. A multiplex PCR approach with strain-specific primers was developed. The method showed a sensitivity threshold of 10 cells/ml. This new molecular method could provide useful information for the characterization of fecal pollution sources.

Animals↗

PubMed2003

Comparison of enterococcal populations related to urban and hospital wastewater in various climatic and geographic European regions.

AIMS: Scarce knowledge about the distribution of enterococci species in wastewaters limits any statement on their reliability as faecal indicators or the implications of antibiotic resistance transmission by these organisms through the water cycle. Enterococci have been involved in nosocomial infections and the spreading of antibiotic resistance through the food chain. The species distribution of enterococci and the presence of resistant strains to vancomycin and erythromycin were analysed in more than 400 raw and treated urban wastewaters, surface waters receiving these treated wastewaters and hospital wastewaters from three European countries. METHODS AND RESULTS: A total of 9296 strains were isolated and biochemically phenotyped. The species identification was based on the comparison of biochemical profiles with those of more than 20000 enterococci isolates from an international study. The prevalence of enterococcal isolates resistant to erythromycin (ERE) and vancomycin (VRE) was also analysed. ERE strains were present in a high proportion in all the studied samples. VRE strains were also isolated in all studied countries despite the time elapsed since the use of antimicrobial glycopeptides in animal production was banned in the European Union. CONCLUSIONS: Enterococcus faecalis and Ent. faecium were the most abundant species in all the studied wastewaters. All the studied wastewaters demonstrated high diversity and similar population structure and composition. ERE and VRE isolates were detected in most of the wastewaters. SIGNIFICANCE AND IMPACT OF THE STUDY: Urban and hospital wastewaters are useful targets for the evaluation of the prevalence of ERE and VRE isolates in the environment. It appears that these bacteria could pass through wastewater treatment plants and be transferred to surface waters.

Cities↗

PubMed2003

Detection, enumeration and isolation of strains carrying the stx2 gene from urban sewage.

Verotoxigenic Escherichia coli strains have been related with waterborne outbreaks. Besides 0157:H7, several serotypes of E. coli and other enterobacteria have been implicated in outbreaks and reported to carry the shiga toxin genes. Shiga toxins, stx1 and stx2, are important virulence factors of these strains. These genes have been linked to bacteriophages and consequently are susceptible to lateral transmission. To better understand the ecology of these genes a study of the presence of the shiga toxin 2 gene (stx2) among coliform bacteria present in sewage samples was carried out. A procedure based on colony hybridisation was developed for the isolation of enterobacteria carrying this gene. Colony growth on Chromocult agar was transferred to a membrane and hybridised with a gene specific probe. The procedure allowed detection of about one colony carrying the gene among around 1,000 faecal coliform colonies. The numbers of bacteria carrying the gene in sewage were also estimated by PCR indicating that the numbers of bacteria carrying the stx2 gene were about 1/1,000 faecal coliforms. The detected numbers by both methods were similar. Positive colony hybridisation was detected in four sewage origins. Fifty-two colonies showing positive signal were isolated from the Chromocult agar plates, confirmed to be stx2 positive by PCR and phenotypically characterised. Results of the characterisation showed certain diversity among the isolates even in isolates from the same sample. Most of these isolates would not have been isolated with the methods regularly used for the isolation of E. coli 0157:H7 strains. The method will allow study of the numbers and characteristics of bacteria carrying the stx2 gene in different water environments and isolate them in order to determine their role in the spread of the gene.

Enterobacteriaceae↗

PubMed2002

The effect of a sewage treatment plant effluent on the faecal coliforms and enterococci populations of the reception river waters.

AIMS: A rural sewage treatment plant and the effect of its effluent on the enterococci and faecal coliforms populations of the receiving river waters was evaluated. METHODS AND RESULTS: The enumeration of bacteria was performed by membrane filtration. Diversity and population similarity were analysed using the PhP-plates system. The treatment plant reduces the number of enterococci and faecal coliforms to values similar to those observed upstream. All water samples showed a high diversity for both bacterial populations. A high similarity in the composition and structure, was detected among all the samples. CONCLUSIONS: The impact of the disposal of treated sewage on the river did not modify the composition of either bacterial populations in the river water. SIGNIFICANCE AND IMPACT OF THE STUDY: The biochemical phenotyping of bacterial populations is a reliable tool for ecological and biodiversity studies. The obtained results provide a better understanding of the sewage treatment process and the impact of the treated sewage effluents in the environment.

Enterobacteriaceae↗

PubMed2002

Detection and identification of Vibrio scophthalmi in the intestinal microbiota of fish and evaluation of host specificity.

AIMS: To develop a species-specific probe (VSV3) for the detection of Vibrio scophthalmi in fish intestine and to apply this probe to study the host specificity of V. scophthalmi. METHODS AND RESULTS: A specific probe (VSV3) based on the variable region V3 of the 16S rRNA gene (rDNA) was designed. Its specificity was tested by DNA-DNA hybridization and by colony hybridization. No cross-hybridization was found. The sensitivity of the probe was tested both by DNA-DNA hybridization and by colony hybridization. The detection limit of V. scophthalmi 16S rDNA was 150 pg or 10 cfu. Vibrio scophthalmi cells were detected in experimental samples constituted by mixed cultures when present in proportions of 1 : 10 and 1 : 100. The VSV3 probe also proved to be reliable for the detection of V. scophthalmi in samples of fish intestine. CONCLUSIONS: The VSV3 probe can be used for the detection of V. scophthalmi in colony hybridization or DNA-DNA hybridization of amplified 16S rDNA. Preliminary results indicate that V. scophthalmi may present certain host specificity for turbot. SIGNIFICANCE AND IMPACT OF THE STUDY: The VSV3 probe provides a useful tool for ecological studies.

Animals↗

PubMed2001

Comparison of selective media for the detection of Vibrio vulnificus in environmental samples.

AIMS: To compare two selective agars, cellobiose-colistin (CC) agar and a modification of the Vibrio vulnificus medium (VVMc agar), for the isolation of Vibrio vulnificus from environmental samples. METHODS AND RESULTS: The efficiencies of recovery of V. vulnificus collection strains on CC, VVM, VVMc and on thiosulphate-citrate-bile salts-sucrose (TCBS) agar were compared and similar efficiencies were obtained. A slightly higher recovery was observed on VVMc agar. The detection of V. vulnificus in environmental samples (eels and water) was performed by combining culture-based methods (CC and VVMc agars) with DNA-based methods using species-specific probes based on the cytolysin-haemolysin and the 16S rDNA genes. A lower accompanying microbiota was found on CC agar than on VVMc agar. CONCLUSION: The comparison between CC and VVMc agars confirms that both are useful for the detection of V. vulnificus in environmental samples. However, the use of any of these media should be combined with a species-specific probe. SIGNIFICANCE AND IMPACT OF THE STUDY: The combined use of a selective medium and a specific probe provides a feasible method for the detection of V. vulnificus for epidemiological and ecological studies.

Cell Culture Techniques↗

PubMed2001

Diversity of Vibrio spp. populations in several exhibition aquaria with a shared water supply.

AIMS: Abiotic factors may influence the settlement of bacterial populations in similar marine environments. Exhibition aquaria are a model for the study of the settlement of bacteria in different environment. Vibrio populations in the seawater reservoir, the Mediterranean tank and the Tropical tank from an exhibition aquarium on the western coast of the Mediterranean were compared and the effect of abiotic factors on the structure of these populations was considered. METHODS AND RESULTS: High diversity indexes and similar Vibrio populations were found in the water of the reservoir and of the Mediterranean tank, whereas a lower diversity and different main populations were found in the water of the Tropical tank. The antibiotic resistance profiles of the most representative strains, presented a number of differences depending on the origin of the sample. CONCLUSION: Abiotic conditions, mainly temperature, may determine the structure and composition of Vibrio populations in exhibition aquaria. SIGNIFICANCE AND IMPACT OF THE STUDY: Bacterial monitoring of water could be useful for health management of aquatic environments.

Animals↗

PubMed2000

Epidemiology and ecology of enterococci, with special reference to antibiotic resistant strains, in animals, humans and the environment. Example of an ongoing project within the European research programme.

The objectives of the present study are to generate knowledge of the ecology and epidemiology of enterococci in the food chain by studying the following: (1) the population structure (in measures of abundance, number of vancomycin resistant strains, antibiotic resistance patterns, diversity, and stability) among enterococcal populations in different geographical regions and in different links of the food chain (2) possible transmission of strains through the food chain and between hospital environments and the food chain (3) the association between vancomycin resistance and individual strains of enterococci and (4) the diversity of the drug resistance genes in enterococci. So far, 1578 samples have been collected from different countries within the EU (Sweden, Denmark, UK and Spain), and from different habitats (pig farms, carcasses in slaughter houses, soil, manure, water, sewage, and humans). Total and vancomycin resistant enterococcal populations in each sample have been enumerated and more than 12000 isolates have been characterised by phenotyping. Representative isolates are further species identified and characterised by genotyping and MIC determination and from antibiotic resistant isolates the resistance genes are characterised.

Animals↗

PubMed2000

A selective medium and a specific probe for detection of Vibrio vulnificus.

A selective medium (VVM) and a specific 16S rRNA gene (rDNA) probe (V3VV) for the detection of Vibrio vulnificus were developed. The medium contains D-(+)-cellobiose as the main carbon source and electrolytes (MgCl(2)-6H(2)O and KCl), which stimulate bacterial growth. Polymyxin B, colistin, and moderate alkalinity and salinity provide selectivity properties. V. vulnificus grows on VVM as flat, bright yellow colonies. Other Vibrio species tested either did not grow or showed green-bluish colonies, with the exception of V. campbelli, V. carchariae, and V. navarrensis. There is a higher colony count on VVM agar than on cellobiose-colistin agar or on modified cellobiose-polymyxin B-colistin agar. The specific probe was evaluated by colony hybridization and dot blot hybridization with PCR-amplified 16S rDNA using collection strains and environmental isolates. No strain studied other than V. vulnificus showed positive hybridization with this oligonucleotide. The combined use of VVM agar and the V3VV probe provided the recovery of V. vulnificus from mixed bacterial suspensions and spiked mussels.

Animals↗

PubMed1999

Identification of Enterococcus spp. with a biochemical key.

A six-step biochemical key is presented for the identification of all recognized Enterococcus spp. The key consists of 12 tests, but no more than 6 are needed for the most complicated identification. The reliability of the key has been evaluated with collection type strains and clinical and environmental isolates. This key has fewer tests than those reported in previous studies. There is no commercial kit that includes the whole set of tests. However, some of the tests are included in enzyme activity-based kits that could be used with the proposed key. The key is designed for use in routine applications, especially in environmental and clinical studies with a high number of isolates.

Enterococcus↗

PubMed1999

A new selective medium for Bifidobacterium spp.

A new selective antibiotic-free medium for Bifidobacterium spp. is defined. This medium has lactulose as the main carbon source and includes methylene blue, propionic acid, and lithium chloride as inhibitors of some related bacterial species. The low pH of the medium contributes to the inhibition of the growth of Enterobacteriaceae. This new selective medium has a simple composition, and the level of recovery it yields is similar to those yielded by nonselective media for Bifidobacterium strains. It could thus be used for routine analysis in environmental or food microbiology.

Bacteriological Techniques↗

PubMed1998

Evaluation of the immunospecificity of the porin Om1 of Vibrio anguillarum serotype O1.

Three methods of immunoanalysis (immunoblot, ELISA and dot-blot) were used to evaluate the immunospecificity of the antiserum against the porin Om1 of Vibrio anguillarum serotype O1 with respect to all the serotypes of V. anguillarum, different Vibrio species and other Gram-negative genera. In the immunoblot analysis of the outer membrane proteins, this antiserum cross-reacted with the main outer membrane protein (MOMP) of all the Vibrio strains studied but not with other genera, except Plesiomonas shigelloides. However, when analyses were performed using whole cells as antigens (ELISA and dot-blot), the antiserum was more specific for V. anguillarum.

Animals↗

PubMed1996

Species-Specific Detection of Vibrio anguillarum in Marine Aquaculture Environments by Selective Culture and DNA Hybridization.

Methods for specific detection of Vibrio anguillarum in complex microbial communities within diverse marine aquaculture environments were evaluated. A system for the detection of culturable cells based on the combined use of a selective medium and a nonradioactively labeled oligodeoxynucleotide complementary to 16S rRNA was developed. Four hundred fourteen bacterial cultures were evaluated in order to assess the specificity of the method. When both the selective medium and the specific probe gave positive results, the cultures were always identified as V. anguillarum. The selectivity for colony hybridization was 1 V. anguillarum cell in 10,000 total bacterial cells in environmental samples. The utility of the method was also compared with detection by dot blot hybridization of either raw DNA purified from environmental samples or PCR-amplified DNA of 16S rRNA genes, using universal eubacterial primers. The post-PCR hybridization was more sensitive (8 x 10(sup2) cells) than direct hybridization of the whole purified DNA (10(sup6) cells). However, the selective medium-probe combined method was as sensitive as post-PCR hybridization, albeit more specific.

Journal Article↗

PubMed1996

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.

Base Sequence↗

PubMed1994

A set of keys for biochemical identification of environmental Vibrio species.

A set of biochemical keys which provide fast and presumptive identification for Vibrio spp. is presented. They have been specially designed for environmental isolates, and can be used for strains that are Gram-negative, give a positive oxidase test, grow on TCBS medium and are facultative anaerobes. The keys are constituted by 28 tests and a maximum of 10 tests are needed for the most complicated identification. They have been designed for routine purposes, especially for studies with a high number of isolates. Some tests are included in enzyme-activity based kits that could be used with these keys through certain results, principally for environmental isolates, should be confirmed by standard methods.

Bacterial Typing Techniques↗