Biomedical subjects

A R Brasier

Publications and source records attributed to A R Brasier.

At least 19 recordsLinked to original sources

PubMed2001

NF-kappaB/RelA transactivation is required for atypical protein kinase C iota-mediated cell survival.

In chronic myelogenous leukemia (CML), the oncogene bcr-abl encodes a dysregulated tyrosine kinase that inhibits apoptosis. We showed previously that human erythroleukemia K562 cells are resistant to antineoplastic drug (taxol)-induced apoptosis through the atypical protein kinase C iota isozyme (PKC iota), a kinase downstream of Bcr-Abl. The mechanism(s) by which PKC iota mediates cell survival to taxol is unknown. Here we demonstrate that PKC iota requires the transcription factor nuclear factor-kappaB (NF-kappaB) to confer cell survival. At apoptosis-inducing concentrations, taxol weakly induces IkappaB(alpha) proteolysis and NF-kappaB translocation in K562 cells, but potently induces its transcriptional activity. Inhibition of NF-kappaB activity (by blocking IkappaB(alpha) degradation) significantly sensitizes cells to taxol-induced apoptosis. Likewise, K562 cells expressing antisense PKC iota mRNA or kinase dead PKC iota (PKC iota-KD) are sensitized to taxol; these cells are rescued from apoptosis by NF-kappaB overexpression. Expression of constitutively active PKC iota (PKC iota-CA) upregulates NF-kappaB transactivation and rescues cells from apoptosis in the absence of Bcr-Abl tyrosine kinase activity. Using a chimeric GAL4-RelA transactivator, we find that taxol potently activates GAL4-RelA-dependent transcription. This activation was further upregulated by expression of PKC iota-CA and inhibited by expression of PKC iota-KD. Our results indicate that RelA transactivation is an important downstream target of the PKC iota-mediated Bcr-Abl signaling pathway and is required for resistance to taxol-induced apoptosis.

Cell Survival↗

PubMed2001

NF-kappa B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-kappa B1 residence.

NF-kappa B is a transcription factor whose nuclear residence is controlled by I kappa B family members. In the NF-kappa B-I kappa B autoregulatory loop, activated (nuclear) Rel A.NF-kappa B1 induces the resynthesis of I kappa B alpha recapturing nuclear Rel A back into the cytoplasm within 1 h of stimulation. In contrast, NF-kappa B1 subunits redistribute more slowly into the cytoplasm (from 6 to 12 h). Here we examine the role of inducible cytoplasmic BCL-3 expression in terminating nuclear NF-kappa B1. Although BCL-3 is a nuclear protein in B lymphocytes, surprisingly, BCL-3 is primarily a cytoplasmic protein in HepG2 cells. Cytoplasmic BCL-3 abundance is induced 6-12 h after tumor necrosis factor-alpha stimulation where it complexes with NF-kappa B1 homodimers. Moreover, BCL-3 mRNA and protein expression are induced by NF-kappa B-activating agents. Two observations are interpreted to indicate that bcl-3 is transactivated by NF-kappa B/Rel A: 1) expression of a dominant negative NF-kappa B inhibitor blocks tumor necrosis factor-alpha-induced BCL-3 expression and 2) expression of constitutively active Rel A is sufficient to induce BCL-3 expression. In gene transfer studies, we identify two high affinity NF-kappa B-binding sites, kappa B1 (located at -872 to -861 nucleotides) and kappa B2 (-106 to -96 nucleotides), and although both bind with high affinity to Rel A, only kappa B2 is required for NF-kappa B-dependent induction of the native BCL-3 promoter. Down-regulation of BCL-3 induction results in prolonged, enhanced NF-kappa B1 binding and increased NF-kappa B-dependent transcription. Together, these data suggest the presence of an NF-kappa B-BCL-3 autoregulatory loop important in terminating NF-kappa B1 action and that individual NF-kappa B isoforms are actively terminated through coordinate induction of inhibitory I kappa B molecules to restore cellular homeostasis.

B-Cell Lymphoma 3 Protein↗

PubMed2001

Oxidant tone regulates RANTES gene expression in airway epithelial cells infected with respiratory syncytial virus. Role in viral-induced interferon regulatory factor activation.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part, through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normal T-cells expressed and secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study we investigated the role of reactive oxygen species in the induction of RANTES gene expression in human type II alveolar epithelial cells (A549), following RSV infection. Our results indicate that RSV infection of airway epithelial cells rapidly induces reactive oxygen species production, prior to RANTES expression, as measured by oxidation of 2',7'-dichlorofluorescein. Pretreatment of airway epithelial cells with the antioxidant butylated hydroxyanisol (BHA), as well a panel of chemically unrelated antioxidants, blocks RSV-induced RANTES gene expression and protein secretion. This effect is mediated through the ability of BHA to inhibit RSV-induced interferon regulatory factor binding to the RANTES promoter interferon-stimulated responsive element, that is absolutely required for inducible RANTES promoter activation. BHA inhibits de novo interferon regulator factor (IRF)-1 and -7 gene expression and protein synthesis, and IRF-3 nuclear translocation. Together, these data indicates that a redox-sensitive pathway is involved in RSV-induced IRF activation, an event necessary for RANTES gene expression.

Base Sequence↗

PubMed2001

Multiple cis regulatory elements control RANTES promoter activity in alveolar epithelial cells infected with respiratory syncytial virus.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normally T-cell expressed and presumably secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study, we analyzed the mechanism of RSV-induced RANTES promoter activation in human type II alveolar epithelial cells (A549 cells). Promoter deletion and mutagenesis experiments indicate that RSV requires the presence of five different cis regulatory elements, located in the promoter fragment spanning from -220 to +55 nucleotides, corresponding to NF-kappaB, C/EBP, Jun/CREB/ATF, and interferon regulatory factor (IRF) binding sites. Although site mutations of the NF-kappaB, C/EBP, and CREB/AP-1 like sites reduce RSV-induced RANTES gene transcription to 50% or less, only mutations affecting IRF binding completely abolish RANTES inducibility. Supershift and microaffinity isolation assays were used to identify the different transcription factor family members whose DNA binding activity was RSV inducible. Expression of dominant negative mutants of these transcription factors further established their central role in virus-induced RANTES promoter activation. Our finding that the presence of multiple cis regulatory elements is required for full activation of the RANTES promoter in RSV-infected alveolar epithelial cells supports the enhanceosome model for RANTES gene transcription, which is absolutely dependent on binding of IRF transcription factors. The identification of regulatory mechanisms of RANTES gene expression is fundamental for rational design of inhibitors of RSV-induced lung inflammation.

CCAAT-Enhancer-Binding Protein-beta↗

PubMed2001

Expression of respiratory syncytial virus-induced chemokine gene networks in lower airway epithelial cells revealed by cDNA microarrays.

The Paramyxovirus respiratory syncytial virus (RSV) is the primary etiologic agent of serious epidemic lower respiratory tract disease in infants, immunosuppressed patients, and the elderly. Lower tract infection with RSV is characterized by a pronounced peribronchial mononuclear infiltrate, with eosinophilic and basophilic degranulation. Because RSV replication is restricted to airway epithelial cells, where RSV replication induces potent expression of chemokines, the epithelium is postulated to be a primary initiator of pulmonary inflammation in RSV infection. The spectrum of RSV-induced chemokines expressed by alveolar epithelial cells has not been fully investigated. In this report, we profile the kinetics and patterns of chemokine expression in RSV-infected lower airway epithelial cells (A549 and SAE). In A549 cells, membrane-based cDNA macroarrays and high-density oligonucleotide probe-based microarrays identified inducible expression of CC (I-309, Exodus-1, TARC, RANTES, MCP-1, MDC, and MIP-1 alpha and -1 beta), CXC (GRO-alpha, -beta, and -gamma, ENA-78, interleukin-8 [IL-8], and I-TAC), and CX(3)C (Fractalkine) chemokines. Chemokines not previously known to be expressed by RSV-infected cells were independently confirmed by multiprobe RNase protection assay, Northern blotting, and reverse transcription-PCR. High-density microarrays performed on SAE cells confirmed a similar pattern of RSV-inducible expression of CC chemokines (Exodus-1, RANTES, and MIP-1 alpha and -1 beta), CXC chemokines (I-TAC, GRO-alpha, -beta, and -gamma, and IL-8), and Fractalkine. In contrast, TARC, MCP-1, and MDC were not induced, suggesting the existence of distinct genetic responses for different types of airway-derived epithelial cells. Hierarchical clustering by agglomerative nesting and principal-component analyses were performed on A549-expressed chemokines; these analyses indicated that RSV-inducible chemokines are ordered into three related expression groups. These data profile the temporal changes in expression by RSV-infected lower airway epithelial cells of chemokines, chemotactic proteins which may be responsible for the complex cellular infiltrate in virus-induced respiratory inflammation.

Cell Line↗

PubMed2001

IFN-beta mediates coordinate expression of antigen-processing genes in RSV-infected pulmonary epithelial cells.

Major histocompatibility complex (MHC) class I-restricted cytotoxic T lymphocytes (CTLs) clear respiratory tract infections caused by the pneumovirus respiratory syncytial virus (RSV) and also mediate vaccine-induced pulmonary injury. Herein we examined the mechanism for RSV-induced MHC class I presentation. Like infectious viruses, conditioned medium from RSV-infected cells (RSV-CM) induces naive cells to coordinately express a gene cluster encoding the transporter associated with antigen presentation 1 (TAP1) and low molecular mass protein (LMP) 2 and LMP7. Neutralization of RSV-CM with antibodies to interferon (IFN)-beta largely blocked TAP1/LMP2/LMP7 expression, whereas anti-interleukin-1 antibodies were without effect, and recombinant IFN-beta increased TAP1/LMP2/LMP7 expression to levels produced by RSV-CM. LMP2, LMP7, and TAP1 expression were required for MHC class I upregulation because the irreversible proteasome inhibitor lactacystin or transfection with a competitive TAP1 inhibitor blocked inducible class I expression. We conclude that RSV infection coordinately increases MHC class I expression and proteasome activity through the paracrine action of IFN-beta to induce expression of the TAP1/LMP2/LMP7 locus, an event that may be important in the initiation of CTL-mediated lung injury.

ATP Binding Cassette Transporter, Subfamily B, Mem↗

PubMed2001

Inhibition of proteasome activity blocks the ability of TNF alpha to down-regulate G(i) proteins and stimulate lipolysis.

Prolonged treatment of rat adipocytes with TNF alpha increases lipolysis through a mechanism mediated, in part, by down-regulation of inhibitory G proteins (G(i)). Separately, down-regulation of G(i) by prolonged treatment with an A(1)-adenosine receptor agonist, N(6)-phenylisopropyl adenosine (PIA) increases lipolysis. To investigate the role of proteolysis in TNF alpha and PIA-mediated G(i) down-regulation and stimulation of lipolysis, we used the protease inhibitors lactacystin (proteasome inhibitor) and calpeptin (calpain inhibitor). Rat adipocytes were preincubated for 1 h with lactacystin (10 microM) or calpeptin (50 microM), before 30-h treatment with either TNF alpha (50 ng/ml) or PIA (300 nM). We then measured lipolysis (glycerol release), abundance of alpha-subunits of G(i)1 and G(i)2 in plasma membranes (Western blotting) and protease activities (in specific fluorogenic assays). TNF alpha and PIA stimulated lipolysis approximately 2-fold and caused G(i) down-regulation. Although neither lactacystin nor calpeptin affected basal lipolysis, lactacystin completely inhibited both TNF alpha and PIA-stimulated lipolysis (the 50% inhibitory concentration was approximately 2 microM), whereas calpeptin had no effect. Similarly, lactacystin but not calpeptin blocked both PIA and TNF alpha-induced G(i) down-regulation. These findings provide further evidence that the chronic lipolytic effect of TNF alpha and PIA is secondary to G(i) down-regulation and suggest that the mechanism involves proteolytic degradation mediated through the proteasome pathway.

Acetylcysteine↗

PubMed2001

Role of signal transducers and activators of transcription 1 and -3 in inducible regulation of the human angiotensinogen gene by interleukin-6.

The circulating level of angiotensinogen (AGT) is dynamically regulated as an important determinant of blood pressure and electrolyte homeostasis. Because the mechanisms controlling the regulated expression of human angiotensinogen (hAGT) are unknown, we investigated the inducible regulation of the hAGT gene in well differentiated HepG2 cells. Interleukin-6 (IL-6) stimulation produced a 3.2-fold increase in hAGT mRNA peaking at 96 h after stimulation. Deletional mutagenesis of the hAGT promoter in transient transfection assays identified an IL-6 response domain between nucleotides -350 and -122 containing three reiterated motifs, termed human acute phase response elements (hAPREs). Although mutation of each site individually caused a fall in IL-6-inducible luciferase activity, mutation of all three sites was required to block the IL-6 effect. Electrophoretic mobility shift assay (EMSA), supershift, and microaffinity DNA binding assays indicate IL-6-inducible high-affinity binding of signal transducers and activators of transcription 1 and -3 (STAT1 and -3) to hAPRE1 and -3 but only low-affinity binding to hAPRE2. Expression of a dominant-negative form of STAT3, but not STAT1, produced a concentration-dependent reduction in IL-6-induced hAGT transcription and endogenous mRNA expression. These data indicate that STAT3 plays a major role in hAGT gene induction through three functionally distinct hAPREs in its promoter and suggest a mechanism for its up-regulation during the acute-phase response.

Acute-Phase Proteins↗

PubMed2000

Requirement of a novel upstream response element in respiratory syncytial virus-induced IL-8 gene expression.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part, through its ability to induce chemokine synthesis in infected airway epithelial cells. In this study, we compare mechanisms for induction of the CXC chemokine IL-8, in human type II alveolar (A549) cells by RSV infection and by stimulation with the cytokine TNF. Promoter deletion and mutagenesis experiments indicate that although the region from -99 to -54 nt is sufficient for TNF-induced IL-8 transcription, this region alone is not sufficient for RSV-induced IL-8 transcription. Instead, RSV requires participation of a previously unrecognized element, spanning from -162 to -132 nt, that we term the RSV response element (RSVRE), and a previously characterized element at -132 to -99 nt, containing an AP-1 binding site. RSV infection of A549 cells induces increased RSVRE- and AP-1-binding activities and increased synthesis of IFN regulatory factor-1 protein, which is present in the RSVRE-binding complex. These data confirm that the IL-8 gene enhancers are controlled in a stimulus-specific fashion and participation of distinct promoter elements is required to activate gene transcription. These observations are important for rational design of inhibitors of RSV-induced lung inflammation.

5' Untranslated Regions↗

PubMed2000

Angiotensin II induces nuclear factor (NF)-kappaB1 isoforms to bind the angiotensinogen gene acute-phase response element: a stimulus-specific pathway for NF-kappaB activation.

The vasopressor angiotensin II (AII) activates transcriptional expression of its precursor, angiotensinogen. This biological "positive feedback loop" occurs through an angiotensin receptor-coupled pathway that activates a multihormone-responsive enhancer of the angiotensinogen promoter, termed the acute-phase response element (APRE). Previously, we showed that the APRE is a cytokine [tumor necrosis factor-alpha (TNFalpha)]- inducible enhancer by binding the heterodimeric nuclear factor-kappaB (NF-kappaB) complex Rel A x NF-kappaB1. Here, we compare the mechanism for NF-kappaB activation by the AII agonist, Sar1 AII, with TNFalpha in HepG2 hepatocytes. Although Sar1 AII and TNFalpha both rapidly activate APRE-driven transcription within 3 h of treatment, the pattern of inducible NF-kappaB binding activity in electrophoretic mobility shift assay is distinct. In contrast to the TNFalpha mechanism, which strongly induces Rel A x NF-kappaB1 binding, Sar1 AII selectively activates a heterogenous pattern of NF-kappaB1 binding. Using a two-step microaffinity DNA binding assay, we observe that Sar1 AII recruits 50-, 56-, and 96-kDa NF-kappaB1 isoforms to bind the APRE. Binding of all three NF-kappaB1 isoforms occurs independently of changes in their nuclear abundance or proteolysis of cytoplasmic IkappaB inhibitors. Phorbol ester-sensitive protein kinase C (PKC) isoforms are required because PKC down-regulation completely blocks AII-inducible transcription and inducible NF-kappaB1 binding. We conclude that AII stimulates the NF-kappaB transcription factor pathway by activating latent DNA-binding activity of NF-kappaB subunits through a phorbol ester-sensitive (PKC-dependent) mechanism.

Angiotensin II↗

PubMed2000

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Animals↗

PubMed2000

Angiotensin II induces gene transcription through cell-type-dependent effects on the nuclear factor-kappaB (NF-kappaB) transcription factor.

The vasopressor octapeptide, angiotensin II (Ang II), exerts homeostatic responses in cardiovascular tissues, including the heart, blood vessel wall, adrenal cortex and liver (a major source of circulating plasma proteins). One of the effects of Ang II is to induce expression of regulatory, structural and cytokine genes that play important roles in long-term control of blood pressure, vascular remodeling, cardiac hypertrophy and inflammation. The identification of nuclear signaling pathways and target transcription factors has provide important insight into cellular responses and the spectrum of genes controlled by Ang II. Here we will review how Ang II activates the transcription factors, Activator Protein 1 (AP-1), Signal Transducer and Activator of Transcription (STATs), and Nuclear Factor-kappaB (NF-kappaB). NF-kappaB is of particular interest because it is an important mediator of resynthesis of the Ang II precursor, angiotensinogen AGT. Through this positive feedback loop, long-term changes in the activity of the renin angiotensin system occur. Although NF-kappaB is ubiquitously expressed, surprisingly the mechanism for Ang II-inducible NF-kappaB regulation differs between aortic smooth muscle cells (VSMCs) and hepatocytes. In VSMC, Ang II induces nuclear translocation of cytoplasmic transactivatory NF-kappaB proteins through proteolysis of its inhibitor, IkappaB. By contrast, in hepatocytes, Ang II induces large nuclear isoforms of NF-kappaB1 to bind DNA through a mechanism independent of changes in IkappaB turnover. NF-kappaB activation depends upon the activity of DAG-sensitive PKC isoforms and ROS signaling pathway. These observations indicate that significant differences exist in Ang II signaling depending upon cell-type involved and suggest the possibility that tissue-selective modulation of Ang II effects is possible in the cardiovascular system.

Angiotensin II↗

PubMed1999

Nuclear factor-kappaB-dependent induction of interleukin-8 gene expression by tumor necrosis factor alpha: evidence for an antioxidant sensitive activating pathway distinct from nuclear translocation.

Tumor necrosis factor alpha (TNFalpha) is a pluripotent activator of inflammation by inducing a proinflammatory cytokine cascade. This phenomenon is mediated, in part, through inducible expression of the CXC chemokine, interleukin-8 (IL-8). In this study, we investigate the role of TNFalpha-inducible reactive oxygen species (ROS) in IL-8 expression by "monocyte-like" U937 histiocytic lymphoma cells. TNFalpha is a rapid activator of IL-8 gene expression by U937, producing a 50-fold induction of mRNA within 1 hour of treatment. In gene transfection assays, the effect of TNFalpha requires the presence of an inducible nuclear factor-kappaB (NF-kappaB) (Rel A) binding site in the IL-8 promoter. TNFalpha treatment induces a rapid translocation of the 65 kD transcriptional activator NF-kappaB subunit, Rel A, whose binding in the nucleus occurs before changes in intracellular ROS. Pretreatment (or up to 15 minutes posttreatment) relative to TNFalpha with the antioxidant dimethyl sulfoxide (DMSO) (2% [vol/vol]) blocks 80% of NF-kappaB-dependent transcription. Surprisingly, however, DMSO has no effect on inducible Rel A binding. Similar selective effects on NF-kappaB transcription are seen with the unrelated antioxidants, N-acetylcysteine (NAC) and vitamin C. These data indicate that TNFalpha induces a delayed ROS-dependent signalling pathway that is required for NF-kappaB transcriptional activation and is separable from that required for its nuclear translocation. Further definition of this pathway will yield new insights into inflammation initiated by TNFalpha signalling.

Antioxidants↗

PubMed1999

Stimulation of a vascular smooth muscle cell NAD(P)H oxidase by thrombin. Evidence that p47(phox) may participate in forming this oxidase in vitro and in vivo.

Thrombin is a potent vascular smooth muscle cell (VSMC) mitogen. Because recent evidence implicates reactive oxygen intermediates (ROI) in VSMC proliferation in general and atherogenesis in particular, we investigated whether ROI generation is necessary for thrombin-induced mitogenesis. Treatment of human aortic smooth muscle cells with thrombin increased DNA synthesis, an effect that was antagonized by diphenyleneiodonium but not by other inhibitors of cellular oxidase systems. This effect of thrombin was accompanied by increased O-2 and H2O2 generation and NADH/NADPH consumption. ROI generation in response to thrombin pretreatment could also be blocked by diphenyleneiodonium, suggesting that the NAD(P)H oxidase was necessary for ROI generation and thrombin-induced mitogenesis. Because of observed differences between the VSMC and neutrophil oxidase, we examined whether the cytosolic components of the phagocytic NAD(P)H oxidase were present in VSMC. p47(phox) and Rac2 were present in VSMC. Furthermore, thrombin increased expression of p47(phox) and Rac2 and stimulated their translocation to the cell membrane. We examined whether p47(phox) might be similarly regulated in vivo in a rat aorta balloon injury model and found that p47(phox) protein was increased after injury. Immunocytochemistry localized expression of p47(phox) to the neointima and media of injured arteries. Our data demonstrate that generation of O-2 and H2O2 is required for thrombin-mediated mitogenesis in VSMC and that p47(phox) is regulated by thrombin in vitro and is associated with vascular lesion formation in vivo.

Animals↗

PubMed1999

Angiotensin II induces interleukin-6 transcription in vascular smooth muscle cells through pleiotropic activation of nuclear factor-kappa B transcription factors.

Interleukin-6 (IL-6) is a multifunctional cytokine expressed by angiotensin II (Ang II)-stimulated vascular smooth muscle cells (VSMCs) that functions as an autocrine growth factor. In this study, we analyze the mechanism for Ang II-inducible IL-6 expression in quiescent rat VSMCs. Stimulation with the Ang II agonist Sar1 Ang II (100 nmol/L) induced transcriptional expression of IL-6 mRNA transcripts of 1.8 and 2.4 kb. In transient transfection assays of IL-6 promoter/luciferase reporter plasmids, Sar1 Ang II treatment induced IL-6 transcription in a manner completely dependent on the nuclear factor-kappaB (NF-kappaB) motif. Sar1 Ang II induced cytoplasmic-to-nuclear translocation of the NF-kappaB subunits Rel A and NF-kappaB1 with parallel changes in DNA-binding activity in a biphasic manner, which produced an early peak at 15 minutes followed by a nadir 1 to 6 hours later and a later peak at 24 hours. The early phase of NF-kappaB translocation was dependent on weak simultaneous proteolysis of the IkappaBalpha and beta inhibitors, whereas later translocation was associated with enhanced processing of the p105 precursor into the mature 50-kDa NF-kappaB1 form. Pretreatment with a potent inhibitor of IkappaBalpha proteolysis, TPCK, completely blocked Sar1 Ang IIAng II-induced NF-kappaB activation and induction of endogenous IL-6 gene expression, which indicated the essential role of NF-kappaB in mediating IL-6 expression. We conclude that Ang II is a pleiotropic regulator of the NF-kappaB transcription factor family and may be responsible for activating the expression of cytokine gene networks in VSMCs.

Angiotensin II↗

PubMed1999

Tumor necrosis factor-alpha-inducible IkappaBalpha proteolysis mediated by cytosolic m-calpain. A mechanism parallel to the ubiquitin-proteasome pathway for nuclear factor-kappab activation.

The cytokine tumor necrosis factor alpha (TNF-alpha) induces expression of inflammatory gene networks by activating cytoplasmic to nuclear translocation of the nuclear factor-kappaB (NF-kappaB) transcription factor. NF-kappaB activation results from sequential phosphorylation and hydrolysis of the cytoplasmic inhibitor, IkappaBalpha, through the 26 S proteasome. Here, we show a parallel proteasome-independent pathway for cytokine-inducible IkappaBalpha proteolysis in HepG2 liver cells mediated by cytosolic calcium-activated neutral protease (calpains). Pretreatment with either calpain- or proteasome-selective inhibitors partially blocks up to 50% of TNF-alpha-inducible IkappaBalpha proteolysis; pretreatment with both is required to completely block IkappaBalpha proteolysis. Similarly, in transient cotransfection assays, expression of the specific inhibitor, calpastatin, partially blocks TNF-alpha-inducible NF-kappaB-dependent promoter activity and IkappaBalpha proteolysis. In TNF-alpha-stimulated cells, a rapid (within 1 min), 2.2-fold increase in cytosolic calpain proteolytic activity is measured using a specific fluorescent assay. Inducible calpain proteolytic activity occurs coincidentally with the particulate-to-cytosol redistribution of the catalytic m-calpain subunit into the IkappaBalpha compartment. Addition of catalytically active m-calpain into broken cells was sufficient to produce ligand-independent IkappaBalpha proteolysis and NF-kappaB translocation. As additional evidence for calpain-dependent IkappaBalpha proteolysis and NF-kappaB activation, we demonstrate that this process occurs in a cell line (ts20b) deficient in the ubiquitin-proteasome pathway. Following inactivation of the temperature-sensitive ubiquitin-activating enzyme, IkappaBalpha proteolysis occurs in a manner sensitive only to calpain inhibitors. Our results demonstrate that TNF-alpha activates cytosolic calpains, a parallel pathway that degrades IkappaBalpha and activates NF-kappaB activation independently of the ubiquitin-proteasome pathway.

Base Sequence↗

PubMed1999

Interleukin-1-induced nuclear factor-kappaB-IkappaBalpha autoregulatory feedback loop in hepatocytes. A role for protein kinase calpha in post-transcriptional regulation of ikappabalpha resynthesis.

The IkappaB inhibitors regulate the activity of the potent transcription factor nuclear factor-kappaB (NF-kappaB). Following signal-induced IkappaB proteolysis, NF-kappaB translocates into the nucleus to activate transcription of target genes, including IkappaBalpha itself, initiating the "NF-kappaB-IkappaBalpha autoregulatory feedback loop." Upon IkappaBalpha resynthesis, NF-kappaB is subsequently inactivated and redistributed back into the cytoplasm. We have previously reported a robust NF-kappaB-IkappaBalpha autoregulatory feedback loop in HepG2 hepatocytes. Sixty minutes after tumor necrosis factor (TNF-alpha) stimulation, IkappaBalpha is resynthesized to approximately 2-fold greater level than in control cells and completely inhibits NF-kappaB binding. Here we investigate the mechanism for IkappaBalpha resynthesis comparing the effect of stimulation of TNF-alpha with that of interleukin-1 (IL-1alpha). Although either TNF-alpha or IL-1alpha stimulation of protein kinase C (PKC)-down-regulated cells equivalently induces NF-kappaB translocation, the kinetics of IkappaBalpha resynthesis is slowed. Moreover, pretreatment with selective calcium-dependent PKC inhibitors selectively slowed the kinetics of the IL-1alpha-induced overshoot without affecting that produced by TNF-alpha. Down-regulation of PKCalpha by antisense phosphorothioate oligonucleotides and expression vectors selectively blocked the IL-1alpha-induced IkappaBalpha overshoot. In the absence of PKCalpha, although IL-1alpha induced similar amounts of IkappaBalpha transcription and changes in steady-state mRNA, a greater component of IkappaBalpha mRNA was retained in the nucleus. These data indicate a selective role for PKCalpha in IL-1alpha-induced IkappaBalpha resynthesis, which is mediated, at least in part, by post-transcriptional control of mRNA export.

Base Sequence↗

PubMed1999

Transcriptional regulation of angiotensinogen gene expression.

The renin--angiotensin system (RAS) is an extracellular hormonal system implicated in acute, homeostatic control of peripheral vascular resistance and electrolyte homeostasis. In this tightly regulated system, physiological regulators of blood pressure and fluid balance induce the production of the potent vasoactive angiotensin peptides by sequential proteolysis of the angiotensinogen (AGT) prohormone. AGT is the only known precursor of the angiotensin peptides, whose circulating concentrations influence the tonic activity of the RAS. AGT abundance is regulated at the transcriptional level through hormonal and cell-type specific regulators. In this review, we will discuss the identified mechanisms controlling AGT expression separately for the rodent and human genes. The most intensively investigated gene (rodent AGT) is regulated constitutively by multiple positive- and negative-acting cis factors that function in a cell-type dependent fashion. Inducible rodent AGT expression is mediated through a multihormone-inducible enhancer that integrates signals from steroid and cytokine hormones into AGT transcription. We review recent advances in understanding the mechanism of the nuclear factor-kappa B (NF-kappa B) family in mediating cytokine-induced AGT expression and our recent discoveries on the existence of differentially inducible pools of cytoplasmic NF-kappa B. Constitutive control of the human AGT gene will be discussed; there is surprisingly little information on the cis- and trans-acting regulators controlling inducible expression of human AGT. Finally, we will explore some of the recent developments in gene linkage studies where human AGT alleles have been associated with hypertensive phenotypes through a mechanism that may involve enhanced transcription. These studies have provided a molecular explanation for a subset of heritable hypertensive disorders in humans.

Angiotensinogen↗