PubMed Health⌕ Search

Biomedical subjects

A R Subramanian

Publications and source records attributed to A R Subramanian.

At least 73 records · Page 4Linked to original sources
PubMed1983

An essential function of ribosomal protein S1 in messenger ribonucleic acid translation.

A gentle and efficient method for selectively removing S1 from ribosomes was developed: the S1-free translation system prepared from such ribosomes is stimulated 10-20-fold (depending on the mRNA) by a stoichiometric amount of added purified S1. With this system, we examined the activity of mono- and di-N-ethylmaleimide derivatives of S1 in protein synthesis using synthetic and natural mRNAs and electrophoretic analysis of the translation products. The results show that ribosomes containing such modified S1's are functionally active although at a somewhat lower level (50-80% activity). Since treatment of S1 with N-ethylmaleimide abolishes the helix-destabilizing ability of S1, we conclude that this ability is not primarily responsible for S1's biological function. A new model for the role of S1 is proposed on the basis of the physical, structural, and RNA-binding properties of S1.

Coliphages↗
PubMed1983

Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat.

Base Sequence↗
PubMed1983

Chemical modification of 5S and 4.5S rRNAs in situ in spinach chloroplast ribosomes.

Spinach chloroplast ribosomes and 50S subunits were reacted with diethylpyrocarbonate under conditions in which their gross structures can be maintained. 5S and 4.5S rRNAs were isolated from such modified particles and the modified adenine residues of these rRNAs were identified by using gel sequencing method. The accessible sites of 5S rRNA in 50S subunits to the reagent were found to be A15, A40 and A89 and that of 5S rRNA in whole ribosomes was restricted to A89. In the case of 4.5S rRNA, A33 was exclusively modified in ribosomes or 50S subunits.

Chloroplasts↗
PubMed1982

Nucleotide sequence and secondary structure analysis of spinach chloroplast 4.5 S RNA.

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be HOAGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGACUUGAACOH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5'-end not found in other chloroplast 4.5 S RNAs and a seven-nucleotide segment absent in the sequences of wheat and maize 4.5 S RNAs. Except for these differences, the sequence of spinach 4.5 S RNA is highly homologous with those of other species. It shows 95% sequence homology to that of tobacco and 78% homology to those of wheat and maize. The secondary structure was probed using limited ribonuclease T1 and nuclease S1 digestions. The results support the 5'-half of the secondary structure model previously proposed for 4.5 S RNA (Machatt, M. A., Ebel, J.-P., and Branlant, C. (1981) Nucleic Acids Res. 9, 1533-1549) but are inconsistent with the rest of that model. An alternative model for spinach 4.5 S RNA is discussed.

Base Sequence↗
PubMed1982

Copies of protein S6 in Escherichia coli ribosomes.

A reinvestigation of the copy number of protein S6 in Escherichia coli ribosomes shows that there is only one copy of S6 in 30 S subunits and in 70 S ribosomes. The previously reported higher value (Subramanian, A. R. (1980) J. Biol. Chem. 255, 6941-6946) is shown to arise from the presence in the usual ribosome preparations of a protein which co-electrophoreses with S6 but does not react with S6 antiserum. This protein is removed when ribosomes are purified by passage through a sucrose gradient.

Centrifugation, Density Gradient↗
PubMed1982

Purification, primary structure, and homology relationships of a chloroplast ribosomal protein.

A chloroplast ribosomal protein that showed immunological homology to Escherichia coli ribosomal protein L12 was purified from spinach (Spinacia oleracea) leaves and its primary structure was determined by manual micro Edman degradation. The protein is composed of 130 amino acid residues and has M(r) 13,576. It shows structural features characteristic of the L12 proteins of eubacterial 70S ribosomes (e.g., identical amino acid residues in about 50% of the sequence) but no apparent homology to the L12-type proteins of eukaryotic cytoplasmic 80S ribosomes. The homology to eubacterial proteins is highest in the COOH-terminal region (70%) and low in the NH(2)-terminal region (<20%).

Journal Article↗
PubMed1982

Primary structure of Escherichia coli ribosomal protein S1 and of its gene rpsA.

The primary structure of proteins S1, the largest protein component of the Escherichia coli ribosome, has been elucidated by determining the amino acid sequence of the protein (from E. coli MRE600) and the nucleotide sequence of the S1 gene (rpsA, of a K-12 strain). The two methods gave results in perfect agreement except of two positions where possible strain specific differences were found. Protein S1 (MRE600) is composed of 557 amino acid residues (no modified amino acids were detected) and has Mr 61,159. The DNA sequence for protein S1 (K-12) suggests 556 amino acid residues. A computer survey of the sequence revealed three regions in S1 with a high degree of internal homology. The ribosome binding domain of S1 (NH2 terminus) does not show any preponderance of basic amino acids. The two cysteine and the majority of tryptophan residues of S1 as well as two od the three homologous regions were located in its middle region which contains the nucleic acid binding domain. The pattern of degenerate codon usage in the S1 gene is nonrandom and similar to that reported for other ribosomal protein genes.

Amino Acid Sequence↗
PubMed1982

Primary structure of Escherichia coli ribosomal protein S1 and features of its functional domains.

The complete covalent structure of ribosomal protein S1 of Escherichia coli has been determined and predictions made of its secondary structure. Protein S1 (E. coli MRE 600) is a single-chain, acidic protein with 557 amino acid residues of the composition Asp43, Asn23, Thr25, Ser25, Glu60, Gln14, Pro10, Gly48, Ala48, Val67, Met6, Ile30, Leu45, Tyr6, Phe17, His8, Lys43, Arg30, Trp7, Cys2 and an Mr of 61159. The two -SH groups of S1 are located in the central region of the chain at positions 292 and 349, the latter being the reactive group whose modification results in the reported loss of the nucleic-acid-unfolding ability of S1. The central region also contains the majority of the tryptophan, histidine and methionine residues of S1 and is predicted to have a secondary structure dominated by beta-sheets and turns. A direct proof for the location of the nucleic-acid-binding domain of S1 in the central region has recently been obtained [Subramanian et al. (1981) Eur. J. Biochem. 119, 245-249]. The N-terminal region of S1, which contains the ribosome-binding domain has a relatively high predicted alpha-helix content and no preponderance of basic amino acids. The facile trypsin-sensitive site in S1 is located at Arg-171, approximately at the border between the N-terminal and central regions. The acidic and basic amino acids of S1 (32.8% of all residues) are distributed throughout the chain, often in small clusters of between two and six residues. The amino acid sequence of S1 contains three 24-residue stretches with strong internal homology. Two of the stretches are located in the central, RNA-binding region, suggesting a possible role in the RNA-binding and helix-destabilizing functions of S1. A fragment of Mr 10(4) from the central region of S1 gives an anomalously high apparent Mr by dodecylsulfate gel electrophoresis, indicating a stable structural element therein and accounting for the apparent high Mr of S1 as determined by gel electrophoresis.

Amino Acid Sequence↗
PubMed1981

Echocardiography.

Explore the source record for details and available documents.

Echocardiography↗
PubMed1981

Fragments of ribosomal protein S1 and its mutant form m1-S1. Localization of nucleic-acid-binding domain in the middle region of S1.

Escherichia coli ribosomal protein S1 and its mutant, shorter, form m1-S1 were cleaved at internal methionyl residues to yield, respectively, six and five fragments of Mr ranging from 1000 to 24000. Methods are described to isolate the fragments in pure form. Four of the fragments (designated F2a, F2b, F3 and F4) contain between 86 and 215 amino acids and are therefore as large as other ribosomal proteins. Fragment F2a, derived from the N-terminal region, has previously been shown to contain the major ribosome binding domain of S1 [S. Giorginis and A. R. Subramanian (1980) J. Mol. Biol. 141, 393--408]. Here we show that the RNA binding domain of S1 is essentially contained in F3 derived from the middle region of S1 and carrying the nonreactive--SH group. The reactive--SH group of S1, whose activity is modified by ligand binding, was localized in F2b, a fragment with little RNA binding capacity. The characteristic RNA binding domain and a weak ribosome binding domain of S1 have previously been localized in the large trypsin-resistent core S1-F1 [T. Suryanarayana and A. R. Subramanian (1979) J. Mol. Biol. 127, 41--54]. Together these data indicate that two of the key functional domain of S1 are located in two regions of the molecule separated by an open, exposed segment. The present study also revealed that the nonreactive--SH group of S1 becomes reactive in m1-S1 by the loss of the remote C-terminal region in the latter.

Cyanogen Bromide↗
PubMed1981

Identity of the B56.5 protein, the A-protein, and the groE gene product of Escherichia coli.

Protein B56.5 is a major Escherichia coli protein, originally identified on two-dimensional gels as an abundant cellular protein with unique regulation. The groE gene product is a bacterial protein essential for the assembly of many diverse bacteriophages. The ribosomal A-protein is a large, acidic protein of unknown function associated with isolated, washed ribosomes. On the basis of comigration in two-dimensional gels, oligopeptide map patterns, amino acid composition, immunological specificity, physical properties, and genetic analysis, protein B56.5 has now been shown to be the groE gene product and to be identical with the A-protein.

Bacterial Proteins↗
PubMed1980

Evidence for a repeated protein structure in the 30 S subunit of Escherichia coli ribosome.

Protein S6 of Escherichia coli ribosome is an acidic protein on the 30 S subunit moiety and it exists in five forms differing only in the number of glutamic acid residues at the COOH terminus. I have determined the total number of copies of all five forms of S6 in the ribosome, using a wild type E. coli (MRE600) and a mutant strain (derivative of K12) that contains only one of these forms (Hitz, H., Schäfer, D., and Wittmann-Liebold, B. (1977) Eur. J. Biochem. 75,497-512). For this purpose, the ribosomes were labeled in vivo with 14C-, 3H-, or 35S-amino acids; bacteria were grown with a variety of carbon sources; and cells were harvested in midlogarithmic and stationary phases. The different forms of S6 were purified and a new procedure capable of electrophoretically separating the five forms of S6 from total ribosomal protein was developed. The results from these experiments show for the first time that there are two copies of protein S6 per ribosome. Thus, a repeat structure of a biochemically modified protein exists not only in the 50S subunit (protein L7/L12) as previously known, but also in the 30 S subunit of the ribosome.

Electrophoresis, Polyacrylamide Gel↗
PubMed1980

Sulfhydryl groups of Escherichia coli ribosomal protein S1. Location along the polypeptide chain.

The location of the functionally important -SH groups of Escherichia coli ribosomal protein S1 along the polypeptide chain has been determined using a cysteine-specific cleavage procedure. The two -SH groups of S1 are located at 57% and 67% of the polypeptide chain length from the NH2 terminus. The -SH group farther from the NH2 terminus is shown to be the more reactive one. Two truncated derivatives of S1 (S1-F1 and m1-S1) both contain two -SH groups. It has previously been shown that S1-F1 (which lacks the NH2-terminal region of S1) is inactive in unfolding nucleic acids, just as the N-ethylmaleimide derivative of S1. The present results therefore show that the formation and functioning of the nucleic acid unfolding domain of protein S1 requires the -SH group(s) as well as the NH2-terminal region.

Cysteine↗
PubMed1980

Functional studies on ribosomes lacking protein L1 from mutant Escherichia coli.

The function of protein L1 in protein biosynthesis has been examined using ribosomes from two independently derived mutants of Escherichia coli, both of which lacked this protein. In systems in vitro with phage MS2 RNA or poly(U) as message, the mutant ribosomes showed from 40% to 60% of the activity of wild-type ribosomes. The reduction in activity was apparent in the kinetics of [14C]phenylalanine incorporation throughout the incubation period. The activities were restored fully to the wild-type level by the addition of purified protein L1. These results show on the one hand that protein L1 is not essential for protein biosynthesis but, on the other, its presence can significantly increase the overall rate of this process. The data further indicate it as likely that protein L1 exerts its effect at the elongation step

Amino Acids↗