PubMed Health⌕ Search

Biomedical subjects

A T Nathan

Publications and source records attributed to A T Nathan.

3 recordsLinked to original sources

The oxygen trail: tissue oxygenation.

Aerobic cellular respiration depends on the efficient supply of oxygen and substrate to the mitochondria. There is an oxygen cascade from the environment to the subcellular environment. Efficient oxygen delivery depends on the coordinated interaction between the respiratory and circulatory systems. The circulation at both macro- and microvascular levels is under the control of humoral and neural factors. There is local autoregulation of flow at the tissue level by metabolic factors which reflect the energy state of the tissues. The response to hypoxia involves the activation of cytokines and genetically controlled factors which maximise capillary perfusion and haemoglobin concentration, and regulate cell metabolism. The formation of reactive oxygen species under such conditions has a detrimental effect on the mitochondria with respiratory chain dysfunction, increased permeability transition, and cell death. This review aims to explore the mechanisms by which the body attempts to maintain tissue oxygen levels at conditions optimal for cell survival.

Humans↗

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.

Animals↗