Biomedical subjects

Alan K Todd

Publications and source records attributed to Alan K Todd.

4 recordsLinked to original sources

PubMed2006

Quadruplex DNA: sequence, topology and structure.

G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes.

Animals↗

PubMed2005

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Base Sequence↗

PubMed2005

Highly prevalent putative quadruplex sequence motifs in human DNA.

We report here the results of a systematic search for the existence and prevalence of potential intramolecular G-quadruplex forming sequences in the human genome. We have also examined the tendency for particular sequences of 'loop' regions to occur in particular positions with respect to the G-tracts in a quadruplex. Using arithmetic ratio and probability techniques we have discovered frequent and systematic occurrence of certain sequence types, the most prominent being a potential quadruplex containing CCTGT in the first 'loop' position. Being able to highlight types of potential quadruplex sequences in G-rich regions is an important step in searching for biologically relevant sequences and finding their function.

Base Sequence↗

PubMed2002

Structural characterisation of bisintercalation in higher-order DNA at a junction-like quadruplex.

We report the single-crystal X-ray structure for the complex of the bisacridine bis-(9-aminooctyl(2-(dimethylaminoethyl)acridine-4-carboxamide)) with the oligonucleotide d(CGTACG)(2) to a resolution of 2.4A. Solution studies with closed circular DNA show this compound to be a bisintercalating threading agent, but so far we have no crystallographic or NMR structural data conforming to the model of contiguous intercalation within the same duplex. Here, with the hexameric duplex d(CGTACG), the DNA is observed to undergo a terminal cytosine base exchange to yield an unusual guanine quadruplex intercalation site through which the bisacridine threads its octamethylene linker to fuse two DNA duplexes. The 4-carboxamide side-chains form anchoring hydrogen-bonding interactions with guanine O6 atoms on each side of the quadruplex. This higher-order DNA structure provides insight into an unexpected property of bisintercalating threading agents, and suggests the idea of targeting such compounds specifically at four-way DNA junctions.

Acridines↗