Biomedical subjects

Anthony P Reszka

Publications and source records attributed to Anthony P Reszka.

7 recordsLinked to original sources

PubMed2006

Discovery of G-quadruplex stabilizing ligands through direct ELISA of a one-bead-one-compound library.

We describe the identification of small-molecule G-quadruplex ligands using a direct ELISA screen of a one-bead-one-compound library of unnatural polyamides displayed on a branched linker with a biotin tag. This general purpose parallel screen for small molecule-oligonucleotide interactions was validated by surface plasmon resonance and ELISA of resynthesized compounds. Linear polyamides displayed similar rankings in their affinity for quadruplex as their branched counterparts. Quadruplex affinity as judged by these surface based techniques was a useful predictor of the ability of the ligands to stabilize the quadruplex to thermal unfolding in solution.

Combinatorial Chemistry Techniques↗

PubMed2006

A conserved quadruplex motif located in a transcription activation site of the human c-kit oncogene.

The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. Mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small variation in sequence between the quadruplex in human/chimpanzee as compared to the rat/mouse was examined more closely by biophysical methods. Despite a variation in the sequence and length of loop 2, the quadruplexes showed both comparable CD spectra, indicative of parallel quadruplexes, and also similar thermal-stability profiles, suggesting conservation of biophysical characteristics. Collectively, the evidence suggests that this quadruplex is a serious target for a detailed functional investigation at the cell-biology level.

Amino Acid Motifs↗

PubMed2006

Structure-specific recognition of quadruplex DNA by organic cations: influence of shape, substituents and charge.

Combining structure-specific recognition of nucleic acids with limited sequence reading is a promising method to reduce the size of the recognition unit required to achieve the necessary selectivity and binding affinity to control function. It has been demonstrated recently that G-quadruplex DNA structures can be targeted by organic cations in a structure-specific manner. Structural targets of quadruplexes include the planar end surfaces of the G-tetrad stacked columns and four grooves. These provide different geometries and functional groups relative to duplex DNA. We have used surface plasmon resonance and isothermal titration calorimetry to show that binding affinity and selectivity of a series of quadruplex end-stacking molecules to human telomeric DNA are sensitive to compound shape as well as substituent type and position. ITC results indicate that binding is largely enthalpy driven. Circular dichroism was also used to identify a group of structurally related compounds that selectively target quadruplex grooves.

Calorimetry↗

PubMed2005

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Base Sequence↗

PubMed2005

The G-quadruplex-interactive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function.

Interference with telomerase and telomere maintenance is emerging as an attractive target for anticancer therapies. Ligand-induced stabilization of G-quadruplex formation by the telomeric DNA single-stranded 3' overhang inhibits telomerase from catalyzing telomeric DNA synthesis and from capping telomeric ends. We report here the effects of a 3,6,9-trisubstituted acridine compound, BRACO-19, on telomerase function in vitro and in vivo. The biological activity of BRACO-19 was evaluated in the human uterus carcinoma cell line UXF1138L, which has very short telomeres (2.7 kb). In vitro, nuclear human telomerase reverse transcriptase (hTERT) expression was drastically decreased after 24 hours, induction of cellular senescence and complete cessation of growth was seen after 15 days, paralleled by telomere shortening of ca. 0.4 kb. In vivo, BRACO-19 was highly active as a single agent against early-stage (68 mm(3)) tumors in a s.c. growing xenograft model established from UXF1138L cells, if given chronically at 2 mg per kg per day i.p. BRACO-19 produced growth inhibition of 96% compared with controls accompanied by partial regressions (P < 0.018). Immunostaining of xenograft tissues showed that this response was paralleled by loss of nuclear hTERT protein expression and an increase in atypical mitoses indicative of telomere dysfunction. Cytoplasmic hTERT expression and its colocalization with ubiquitin was observed suggesting that hTERT is bound to ubiquitin and targeted for enhanced degradation upon BRACO-19 treatment. This is in accord with a model of induced displacement of telomerase from the telomere. The in vitro and in vivo data presented here is consistent with the G-quadruplex binding ligand BRACO-19 producing an anticancer effect by inhibiting the capping and catalytic functions of telomerase.

Acridines↗

PubMed2004

Evaluation of by disubstituted acridone derivatives as telomerase inhibitors: the importance of G-quadruplex binding.

The synthesis and evaluation of a group of 2,6-, 2,7- and 3,6-bis-aminoalkylamido acridones are reported, which show a similar level of activity against telomerase in vitro compared to their acridine counterparts. Computer modelling and calculations of relative binding energies suggest an equivalent binding mode to human intramolecular G-quadruplex DNA, but with significantly reduced affinity, as a result of the limited delocalisation of the acridone chromophore compared to the acridine system. Thermal melting studies on acridone and acridine quadruplex complexes using a FRET approach support these predictions. Long-term cell proliferation studies at sub-cytotoxic doses with two representative acridones using the SKOV3 cell line, show that neither compound produces growth arrest, in contrast with the effects produced by the tri-substituted acridine compound BRACO-19. It is concluded that telomerase inhibitory activity is a necessary though by itself insufficient property in order for cellular growth arrest to occur at sub-toxic concentrations, and that tight quadruplex binding is also required.

Acridines↗

PubMed2003

Trisubstituted acridine derivatives as potent and selective telomerase inhibitors.

The synthesis and evaluation for telomerase-inhibitory and quadruplex DNA binding properties of three related series of rationally designed trisubstituted acridine derivatives are described. These are substituted on the acridine ring at the 2,6,9; 2,7,9; and 3,6,9 positions. The ability of several of the most potent compounds to interact with and stabilize an intramolecular G-quadruplex DNA was evaluated by surface plasmon resonance methods, and affinities were found to correlate with potency in a telomerase assay. The interactions of a number of compounds with a parallel quadruplex DNA structure were simulated by molecular modeling methods. The calculated interaction energies were compared with telomerase activity and showed generally consistent correlations between quadruplex affinity and telomerase inhibition. These data support a model for the action of these compounds that involves the stabilization of intermediate quadruplex structures that inhibit the elongation of telomeric DNA by telomerase in tumor cells.

Acridines↗