Biomedical subjects

B J Bonven

Publications and source records attributed to B J Bonven.

13 recordsLinked to original sources

PubMed2000

Interaction between the transcription factor SPBP and the positive cofactor RNF4. An interplay between protein binding zinc fingers.

The activator of stromelysin 1 gene transcription, SPBP, interacts with the RING finger protein RNF4. Both proteins are ubiquitously expressed and localized in the nucleus. RNF4 facilitates accumulation of specific SPBP-DNA complexes in vitro and acts as a positive cofactor in SPBP-mediated transactivation. SPBP harbors an internal zinc finger of the PHD/LAP type. This domain can form intra-chain protein-protein contacts in SPBP resulting in negative modulation of SPBP-RNF4 interaction.

3T3 Cells↗

PubMed1995

E-box variants direct formation of distinct complexes with the basic helix-loop-helix protein ALF1.

The murine transcription factor ALF1 belongs to the class of basic helix-loop-helix proteins specific for the NCAGNTGN-version of the E-box. Binding of homodimeric ALF1 to variants of this motif was studied by a combination of binding site selection technology and DNA modification interference analysis. The results showed that substitutions at the non-conserved positions in the E-box sequence could cause profound alterations in the patterns of specific contacts at the protein-DNA interface. Thus, both the overall extent of the binding region and the backbone phosphate contact pattern differed markedly between closely related E-boxes with similar affinities for ALF1. The identity of the base at the inner N was an important determinant of contact pattern specification. The E-box variants differed in their ability to mediate ALF1 dependent transcriptional activation in vivo. We discuss the possibility that adaptability in basic helix-loop-helix protein-DNA interactions can result in complexes with different functional properties.

Amino Acid Sequence↗

PubMed1991

Eukaryotic topoisomerase I-DNA interaction is stabilized by helix curvature.

The influence of DNA structure on topoisomerase I-DNA interaction has been investigated using a high affinity binding site and mutant derivatives thereof. Parallel determinations of complex formation and helix structure in the absence of superhelical stress suggest that the interaction is intensified by stable helix curvature. Previous work showed that a topoisomerase I binding site consists of two functionally distinct subdomains. A region located 5' to the topoisomerase I cleavage site is essential for binding. The region 3' to the cleavage site is covered by the enzyme, but not essential. We report here that the helix conformation of the latter region is an important modulator of complex formation. Thus, complex formation is markedly stimulated, when an intrinsically bent DNA segment is installed in this region. A unique pattern of phosphate ethylation interferences in the 3'-part of the binding site indicates that sensing of curvature involves backbone contacts. Since dynamic curvature in supercoiled DNA may substitute for stable curvature, our findings suggest that topoisomerase I is able to probe DNA topology by assessment of writhe, rather than twist.

Base Sequence↗

PubMed1990

Distamycin inhibition of topoisomerase I-DNA interaction: a mechanistic analysis.

Inhibition of eukaryotic DNA topoisomerase I by the minor groove binding ligand, distamycin A, was investigated. Low concentrations of the ligand selectively prevented catalytic action at a high affinity topoisomerase I binding sequence. A restriction enzyme protection assay indicated that the catalytic cycle was blocked at the binding step. Distamycin binding sites on DNA were localized by hydroxyl radical footprinting. A strongly preferred site mapped to a homopolymeric (dA).(dT)-tract partially included in the essential topoisomerase I binding region. Mutational elimination of the stable helix curvature associated with this ligand binding site demonstrated that (i) the intrinsic bend was unessential for efficient binding of topoisomerase I, and (ii) distamycin inhibition did not occur by deformation of a stable band. Alternative modes of inhibition are discussed.

Animals↗

PubMed1989

Interactions between eukaryotic DNA topoisomerase I and a specific binding sequence.

The interaction between eukaryotic DNA topoisomerase I and a high affinity binding sequence was investigated. Quantitative footprint analysis demonstrated that the substrate preference results from strong specific binding of topoisomerase I to the sequence. The specificity was conferred by a tight noncovalent association between the enzyme and its target DNA, whereas the transient formation of a covalently bound enzyme.nicked DNA intermediate contributed insignificantly to the overall affinity. Topoisomerase I protected both strands over a 20-base pair region in which the cleavage site was centrally located. DNA modification interference analysis revealed a 16-base pair interference region on the scissile strand. Essential bases were confined to the 5' side of the cleavage site. The 6-base pair interference region observed on the complementary strand did not contain essential bases.

Animals↗

PubMed1988

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage.

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.

Base Sequence↗

PubMed1988

Characterization of a camptothecin-resistant human DNA topoisomerase I.

Topoisomerase I purified from a camptothecin-resistant human leukemia cell line and from the parental, camptothecin-sensitive line were compared in vitro. Relaxation of supercoiled DNA by the wild type enzyme was inhibited in the presence of camptothecin, while the mutant enzyme was unimpaired. Camptothecin altered the cleavage pattern of the wild type but not of the mutant enzyme. The stability of cleavable complexes was studied at a preferred topoisomerase I-binding sequence recognized by both enzymes. Camptothecin greatly enhanced the kinetic stability of the cleavable complex formed by the wild type enzyme, whereas that of the mutant enzyme was only marginally affected. In the absence of camptothecin, the cleavable complex formed by the mutant enzyme was stabilized relative to that of the wild type by several criteria. Thus, the mutant enzyme cleaved the topoisomerase I recognition sequence with 2-fold higher efficiency than the wild type enzyme. The mutant cleavable complex had a higher kinetic stability and was less sensitive to salt dissociation than the wild type complex. Furthermore, the mutant enzyme formed cleavable complexes in the absence of divalent cations, which were required for complex formation by the wild type enzyme.

Base Sequence↗

PubMed1987

Mapping of sequence-specific chromatin proteins by a novel method: topoisomerase I on Tetrahymena ribosomal chromatin.

DNA derived from the 5' spacers of the rRNA genes from Tetrahymena has unusual electrophoretic properties. These properties made it possible to devise a simple electrophoretic procedure for isolating specific rDNA spacer fragments from preparations of total nuclear DNA, enabling us to study DNA modifications at the level of unfractionated nuclei. We have employed the method to study the distribution of topoisomerase I binding sites on the r-chromatin (ribosomal chromatin) of Tetrahymena at the DNA sequence level. The presence of topoisomerase I in situ was detected by its ability to introduce single-strand cleavages into DNA. The positions of the cleavages were determined on DNA sequencing gels after isolation of the fragments. Topoisomerase I binding in r-chromatin is sequence specific and cleavage is confined to a 16 base-pair conserved sequence element previously determined to be a high-affinity binding site for topoisomerase I in vitro. The high degree of sequence specificity may be of important functional significance, as we find a similar sequence specificity with enzymes isolated from five evolutionarily distant species, indicating that preference for the 16 base-pair element is an intrinsic property of eukaryotic type I topoisomerases.

Animals↗

PubMed1987

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.

Animals↗

PubMed1985

Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promoter region of the rRNA gene from Tetrahymena pyriformis.

Topoisomerase I is in situ associated with DNaseI hypersensitive sites located in the promotor and terminator regions of the extrachromosomal rDNA in Tetrahymena thermophila at sites with sequences fitting the motif (sequence in text) Reconstitution experiments with purified topoisomerase I and cloned fragments of rDNA demonstrate that the enzyme exhibits the same binding and cleavage properties on naked DNA. These observations are striking as topoisomerase I previously has been found to exhibit low sequence specificity. The specific binding of the enzyme has an absolute requirement for divalent cations with a preference for Ca2+. The strong binding to the hexadecamer has been characterized by competition experiments, and it has been used to determine the molecular weight of the enzyme.

Animals↗

PubMed1985

A high affinity topoisomerase I binding sequence is clustered at DNAase I hypersensitive sites in Tetrahymena R-chromatin.

Topoisomerase I is associated with DNAase I hypersensitive sites in the nontranscribed spacers flanking the rRNA genes in Tetrahymena thermophila. The endogenous topoisomerase I introduces site and strand specific single-strand cleavages in the rDNA spacers in situ. The cleavages occur base specifically within a hexadecameric sequence element present in two or three direct repeats at the hypersensitive sites. The sequence specificity and polarity of the cleavage reaction are identical when the enzyme is reacted with naked rDNA, indicating that the repetitive element functions as a high-affinity topoisomerase I attraction site in the r-chromatin. The biological mechanism associated with this phenomenon appears to be widespread among eukaryotes, since the topoisomerase I recognition sequence is conserved in the rDNA spacers of phylogenetically remote organisms, such as fungi, slime molds, ciliates, and insects.

Animals↗

PubMed1983

A site and strand specific nuclease activity with analogies to topoisomerase I frames the rRNA gene of Tetrahymena.

Exposure of macronuclear chromatin from Tetrahymena thermophila to sodium dodecyl sulfate causes an endogenous nuclease to cleave the extra-chromosomal rDNA at specific sites. All cuts are single-strand cleavages specific to the non-coding strand. Three cleavages map in the central non-transcribed spacer of the palindromic molecule at positions -1000, -600 and -150 bp with respect to the transcription initiation point. A fourth site is located close to the transcription termination point, while no cleavage is observed in the coding region. The position of each cleavage is in the immediate neighbourhood of DNAse I hypersensitive sites. Additionally, certain DNA sequence motifs are repeated in the region around the cleavages. Upon cleavage induction a protein becomes attached to the rDNA. Our results indicate covalent binding to the generated 3' end, in analogy to the aborted reaction of topoisomerase I.

Animals↗

PubMedDate not supplied

Preferential relaxation of supercoiled DNA containing a hexadecameric recognition sequence for topoisomerase I.

In prokaryotes, the degree of supercoiling of DNA can profoundly influence the use of specific promoters. In eukaryotes, a variety of indirect observations suggest that DNA topology has a similar importance in proper gene expression. Much attention has therefore been focused on the cellular proteins that control DNA supercoiling, among which are the enzymes topoisomerase I and II. A hexadecameric sequence functions as a strong attraction site for topoisomerase I. Here we report that the interaction of topoisomerase I with this sequence motif is highly specific, because a single base-pair substitution prevents strand cleavage and thereby catalytic activity at the sequence. Thus, supercoiled DNA containing the recognition sequence is relaxed preferentially by topoisomerase I compared to a control, but no difference in the relaxation rate is observed for supercoiled DNA carrying the mutated sequence. The preference for the recognition sequence seems to be an intrinsic property of all eukaryotic type I topoisomerases, suggesting that the interaction might be important in a fundamental biological process.

Base Composition↗