PubMed Health⌕ Search

Biomedical subjects

B K Chernov

Publications and source records attributed to B K Chernov.

At least 37 records · Page 2Linked to original sources

Computer-assisted predictions of the secondary structure in the plant virus single-stranded DNA genome.

Coconut foliar decay virus (CFDV) contains the single-stranded circular DNA molecules of 1291 nucleotides which were found to replicate autonomously in the cells of the diseased palms. The special features of the CFDV DNA sequence, including putative secondary structure and the distribution of the inverted repeat motifs, are investigated with computer-assisted prediction methods. It is evident that the structural principle of the branched series of long and short double helixes interspersed by short non-helical regions is existed for CFDV virion DNA. The total degree of base pairing is near 62%. We have also predicted the presence of several sequence elements formed by inverted repeat motifs which are potentially capable of binding the eukaryotic transcriptional regulatory factors.

Base Sequence↗

Parallel-stranded DNA with mixed sequence. Evidence for conformational transition in solution at low water activity.

Parallel-stranded deoxyoligonucleotide 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' (I-II) was shown to be stable in solution at 3 degrees-5 degrees C, 0.1-0.25 M NaCl, 10(-2) M phosphate buffer, pH 7.0 by means of a set of fluorescent techniques as well as of conventional optical methods. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity, r.h.). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2' endo sugar conformation to an A-like form designated as Ap. The free energy difference between the Ap and B-like conformation for the parallel duplex is 7.35 kcal/mol which is close to the value 7.40 kcal/mol for the antiparallel 5'd(CTATAGGGAT)3'/3'd(GATATCCCTA)5' (I-III). The ability of parallel helix to transit into Ap form is important for DNA-RNA parallel double helix formation.

Base Composition↗

Computer search of transcription control sequences in small plant virus DNA reveals a sequence highly homologous to the enhancer element of histone promoters.

The positions of nucleotide sequences which can act as binding sites for plant transcriptional trans-acting protein factors have been mapped in DNA of plant circovirus--coconut foliar decay virus (CFDV). It was found that CFDV promoter region contains sequence motif homologous to the regulatory type I element of plant histone genes. We have also found the presence of the element I motifs in DNAs of other small plant viruses. Taking into account the mechanism of regulation of histone gene expression it appears that these sequences may play a role in a cell cycle-dependent regulation of plant virus DNA transcription and replication.

Base Sequence↗

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence.

The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.

Animals↗

Transfer of foreign DNA into the cells of developing mouse embryos by microprojectile bombardment.

Mouse cells of developing embryos at the 2-4 cell, morula and blastocyst stages, were bombarded by high velocity tungsten microprojectiles. About 70% of developing embryos survived the bombardment. The general embryo structure did not change as a result of the bombardment. Penetration of the tungsten microparticles into the embryo cell nuclei was found at all stages being investigated, and tungsten particle localization on mitotic chromosomes was demonstrated. The total DNA of the mice born from the bombarded embryos was analyzed by dot-blot hybridization and PCR with post-hybridization. The most important results were obtained in experiments with blastocysts. In three cases of blastocyst bombardment, the presence of transferred plasmid DNA (pSV3-neo) was revealed. Transfected cells were shown to be located in the fetal membrane as well as in the embryo. The bombardment of mouse culture cells resulted in their transfection and the production of G418-resistant clones.

Animals↗

Random mutagenesis of the gene for bacteriophage T7 RNA polymerase.

Random mutagenesis of the gene for bacteriophage T7 RNA polymerase was used to identify functionally essential amino acid residues of the enzyme. A two-plasmid system was developed that permits the straightforward isolation of T7 RNA polymerase mutants that had lost almost all catalytic activity. It was shown that substitutions of Thr and Ala for Pro at the position 563, Ser for Tyr571, Pro for Thr636, Asp for Tyr639 and of Cys for Phe646 resulted in inactivation of the enzyme. It is noteworthy that all these mutations are limited to two short regions that are highly conservative in sequences of monomeric RNA polymerases.

Amino Acid Sequence↗

De novo design, synthesis and study of albebetin, a polypeptide with a predetermined three-dimensional structure. Probing the structure at the nanogram level.

The de novo polypeptide named albebetin was designed to form the tertiary fold that has not yet been observed in natural proteins. The design was based on the molecular theory of protein structures. The gene coding for this polypeptide was chemically synthesized. For the initial characterization of a protein structure, a new approach has been developed that uses only nanogram amounts of a polypeptide without its previous purification. This approach includes the biosynthesis of radiolabeled protein in a cell-free translation system with subsequent analysis of its compactness and structure by size-exclusion chromatography, urea-gradient electrophoresis and limited proteolysis. According to all tests used, albebetin has a compact stable structure.

Amino Acid Sequence↗

Southern molecular hybridization experiments with parallel complementary DNA probes.

We have detected the specific binding in Southern blot hybridization experiments of both complementary antiparallel and parallel 40 bp synthetic DNA probes, corresponding to a cloned Drosophila DNA fragment. The highly cooperative annealing and melting were observed in solution with these probes, which are complementary in the same direction and possess 17 GC pairs. The binding of ethidium bromide is indicative of formation of a perfect parallel DNA duplex. The specific binding was also detected in both genomic and in plaque hybridization experiments.

Animals↗

Parallel stranded DNA under the scanning tunnelling microscope.

Using scanning tunnelling microscopy, we have directly observed parallel stranded DNA helixes of 43 nucleotides in length. The double helix is right-handed and has an average spacing, 17.43 A (+/- 1 S.D.: 2.30 A), and an average apparent depth, 4.79 A (+/- 1 S.D.: 1.04 A) for each groove. The average pitch of the helical turn is 34 A (+/- 1 S.D.: 3.35 A) and consists of no more than ten base pairs. The diameter of the helix is approx. 17-20 A. Our results provide direct evidence for the existence of a parallel structure of DNA in vitro and some details of its fine structure.

Base Sequence↗

Variants of the 5'-untranslated sequence of human growth hormone receptor mRNA.

The human growth hormone receptor (GHR) gene was proposed to contain multiple 5'-noncoding exons (Leung et al., 1987). The exact number and structure of these exons are unknown. As a first step in investigating this point more closely, we decided to clone alternative 5'-noncoding sequences of human liver GHR mRNA. The ligation-mediated single-sided polymerase chain reaction (PCR) was applied for selective amplification of 5'-terminal sequences of human liver GHR cDNA. PCR products were cloned and sequenced. Eight different sequence variants diverging in the 5'-untranslated regions beginning 12 base pairs upstream from the initiating ATG codon were found. One variant seems to represent unspliced or partially spliced GHR mRNA. The remaining variants probably correspond to multiple alternatively spliced forms of GHR mRNA. Homologs for three of these variants were found among previously published 5'-noncoding sequences of GHR cDNA obtained from other species by conventional cDNA cloning. Most of the cloned human liver GHR cDNA variants contain one or more ATG preceding the main GHR open reading frame start of translation. Thus, the GHR genes appeared to be a striking example of a very complex transcription unit.

Animals↗

Interaction of lambda cro repressor with synthetic operator OR3 studied by competition binding with minor groove binders.

In the present work, we employ a combination of CD spectroscopy and gel retardation technique to characterize thermodynamically the binding of lambda phage cro repressor to a 17 base pair operator OR3. We have found that three minor groove-binding antibiotics, distamycin A, netropsin and sibiromycin, compete effectively with the cro for binding to the operator OR3. Among these antibiotics, sibiromycin binds covalently to DNA in the minor groove at the NH2 of guanine, whereas distamycin A and netropsin interact preferentially with runs of AT base pairs and avoid DNA regions containing guanine bases in the two polynucleotide strands. Only subtle DNA conformation changes are known to take place upon binding of these antibiotics. Both the CD spectral profiles and the results of the gel retardation experiments indicate that distamycin A and netropsin can displace cro repressor from the operator OR3. The binding of cro repressor to the OR3 is accompanied by considerable changes in CD in the far-UV region which appear to be attributed to a DNA-dependent structural transition in the protein. Spectral changes are also induced in the wavelength region of 270-290 nm. The CD spectral profile of the cro-OR3 mixture in the presence of distamycin A can be represented as a sum of the CD spectrum of the repressor-operator complex and spectrum of distamycin-DNA complex at the appropriate molar ratio of the bound antibiotic to the operator DNA (r). When r tends to the saturation level of binding the CD spectrum in the region of 270-360 nm approaches a CD pattern typical of complexes of the antibiotic with the free DNA oligomer. This suggests that simultaneous binding of cro repressor and distamycin A to the same DNA oligomer is not possible and that distamycin A and netropsin can be used to determine the equilibrium affinity constant of cro repressor to the synthetic operator from competition-type experiments. The binding constant of cro repressor to the OR3 is found to be (6 +/- 1).10(6)M-1 at 20 degrees C in 10 mM sodium cacodylate buffer (pH 7.0) in the presence of 0.1 M NH4F.

Aminoglycosides↗

[Mutagenic effect on Escherichia coli bacteria of 8-hydroxy-2'-deoxyguanosine--a DNA base damage product induced by oxygen radicals and ionizing radiation].

The effect of 8-oxo-2'-deoxyguanosine (8-oxo-dG) (8-hydroxydeoxyguanosine)--a DNA base damage product induced by oxygen radicals and irradiation on survival and mutagenesis in Escherichia coli strains C-600 and P-687 was investigated. Survival and mutagenesis curves, in dependence of 8-oxo-dG concentrations in the medium, ranging from 0.2 through 10 mM, were obtained. Bacterial survival at all 8-oxo-dG concentrations tested was shown to be no lesser than in the control. The mutagenic effect of 8-oxo-dG was tested by frequency of reversions in the absence of leucine and threonine. A non-linear dependence of mutagenesis on the concentration was observed. Linear increase in the amount of revertants took place at concentrations of 8-oxo-dG lower than 1 mM, and being kept constant at higher concentrations. Induction of SOS repair under the action of 8-oxo-dG in E. coli PQ37 strain was estimated according to alteration of activity of beta-galactosidase in the SOS chromotest. Weak induction of the SOS response was observed within the wide range of 8-oxo-dG concentration values, which points to a lack of genotoxicity and independence of mutagenesis on SOS repair.

8-Hydroxy-2'-Deoxyguanosine↗

Binding of proteins of HeLa S3 cell extract to oligonucleotides containing the consensus interferon-response sequence (IRS) and to the IRS-containing fragment of the human c-myc gene.

The human c-myc proto-oncogene was recently found to contain a regulatory sequence similar to the consensus interferon-response sequence (IRS) of interferon-activating genes. Binding of regulatory protein(s) to this sequence of cloned fragment of c-myc, lacking the main part of 5'-nontranscribing region, regulates in vitro transcription from I1/I2 initiation sites located in the first intron of the gene. Here, we have shown that HeLa S3 nuclear extract contains different protein factors, at least two, that bind preferentially to the IRS sequence of either the c-myc gene or the interferon-dependent 6-16 gene. Moreover, each of these factors 'cross-binds' to the region of the other gene, although affinity of this interaction is lower. Binding constants of these proteins to oligonucleotide fragments of c-myc and 6-16 genes were determined. In vitro transcription of the human full-length c-myc gene (i.e. the gene containing the complete 5'-noncoding region) initiated from I1/I2 sites, that is controlled by the IRS region, was demonstrated to be blocked. A possible physiological role for the mechanisms described is discussed.

Base Sequence↗

Lys631 residue in the active site of the bacteriophage T7 RNA polymerase. Affinity labeling and site-directed mutagenesis.

A highly selective affinity labeling of T7 RNA polymerase with the o-formylphenyl ester of GMP and [alpha-32P]UTP was carried out. The site of the labeling was located using limited cleavages with hydroxylamine, bromine, N-chlorosuccinimide and cyanogene bromide and was identified as the Lys631 residue. Site-directed mutagenesis using synthetic oligonucleotides was used to substitute Lys631 by a Gly, Leu or Arg residue. Kinetic studies of the purified mutant enzymes showed alterations of their polymerizing activity. For the Lys----Gly mutant enzyme, anomalous template binding was observed.

Affinity Labels↗