PubMed Health⌕ Search

Biomedical subjects

B Milavetz

Publications and source records attributed to B Milavetz.

10 recordsLinked to original sources
PubMed1999

Chromatin structure of the simian virus 40 late promoter: a deletional analysis.

The goal of this study was to determine the minimal sequence within the simian virus 40 (SV40) late promoter region, nucleotides (nt) 255 to 424, capable of phasing nucleosomes as measured by its ability to confer the greatest endonuclease sensitivity on adjacent DNA sequences. To identify the minimal sequence, a deletional analysis of the late region was performed by utilizing a SV40 recombinant reporter system. The reporter system consisted of a series of unique restriction sites introduced into SV40 at nt 2666. The unique restriction sites allowed the insertion of test sequences as well as measurement of conferred endonuclease sensitivity. The results of the deletional analysis demonstrated that constructs capable of conferring the greatest nuclease sensitivities consistently included nt 255 to 280. The activator protein 4 (AP-4) and GTIIC transcription factor binding sequences lie within this region and were analyzed individually. Their abilities to confer nuclease sensitivity upon the reporter nearly matched that of the entire late domain. These results suggest that transcription factors AP-4 and transcription-enhancing factor which binds the GTIIC sequence are able to confer significant levels of nuclease sensitivity and are likely involved in the formation of the SV40 nucleosome-free region.

Chromatin↗
PubMed1996

Differential regulation by SV40 T-antigen binding at site I defines two distinct classes of nucleosome-free promoter.

BACKGROUND: T-antigen binding site I has been shown previously to play a role in regulating the proportion of Simian Virus 40 (SV40) chromosomes containing a nuclease hypersensitive promoter region. In order to determine whether these changes in nuclease hypersensitivity were a result of changes in the proportion of SV40 chromosomes, which contained a nucleosome-free promoter region, SV40 chromosomes were visualized by electron microscopy. METHODS: SV40 chromosomes were prepared from cells infected with either wild-type or mutant virus lacking T-antigen binding site I, and the chromosomes were analyzed by electron microscopy for the presence of nucleosome-free regions. RESULTS: Both the wild-type and mutant chromatin were found to contain heterogeneous nucleosome-free promoter regions consisting of small (3-4 times the normal internucleosomal distance) and large (greater than four times the normal internucleosomal distance) regions. Quantification of the proportion of chromosomes containing each type of region indicated that deletion of site I resulted in a 25% increase in the proportion of chromosomes containing a large nucleosome-free region but had no effect on the proportion of chromosomes containing a small nucleosome-free region. CONCLUSIONS: The results indicate that there are two distinct classes of nucleosome-free promoter region in SV40 chromatin and that T-antigen binding to site I is specifically involved in the regulation of only the class that contains a large nucleosome-free region.

Animals↗
PubMed1996

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.

Base Sequence↗
PubMed1989

Generation of a nucleosome-free promoter region in SV40 does not require T-antigen binding to site I.

The relationship between T-antigen interactions at Site I and the presence of a nucleosome-free promoter in SV40 chromatin was examined by analyzing chromatin from mutants defective for T-antigen interaction at site I (cs 1085, scs111, and tsA58) and their parental wild-type strains (776, SVS, and VA45-54, respectively). As judged by sensitivity to digestion with restriction endonucleases that recognize unique sequences within the promoter region (BglI, KpnI, and MspI), a nucleosome-free promoter was observed in a substantially larger proportion of chromosomes from the defective mutants than their wild-type parents. This result demonstrates that T-antigen binding to site I is not necessary for setting the early boundary of the nucleosome-free region, although it may function directly or indirectly in determining the proportion of chromosomes containing this feature.

Antigens, Polyomavirus Transforming↗
PubMed1986

Purification of SV40 T-antigen by SV40 DNA-sepharose affinity chromatography.

T-antigen from SV40-infected BSC-1 cells was purified approximately 30,000 fold using a rapid purification procedure consisting of ammonium sulfate fractionation followed by chromatography on hydroxylapatite, blue-sepharose, and SV40 DNA-sepharose. The SV40 DNA-sepharose was optimized for the binding of T-antigen by the covalent attachment of the SV40 DNA at its BamHI site to cyanogen bromide activated sepharose. The most highly purified T-antigen appeared as a single polypeptide of 94 K daltons by polyacrylamide gel electrophoresis.

Adenosine Triphosphatases↗
PubMed1986

Analysis of the origin-specific nucleosome-free region in SV40 encapsidation intermediates.

The presence of a nucleosome-free region at the replication origin in encapsidation intermediates of SV40 was determined by measuring the sensitivity of the intermediates to digestion by restriction endonucleases which lie within (BglI and SphI) or outside of this region (KpnI, MspI, and EcoRI). As judged by hypersensitivity to digestion with BglI and SphI, the origin-specific nucleosome-free region was found to be present in nonencapsidated and partially encapsidated SV40 chromosomes and previrions, but not virions.

Capsid↗
PubMed1982

Simian virus 40 encapsidation: characterization of early intermediates.

Simian virus 40 chromosomes were separated into various species by a two-step purification consisting of low-ionic-strength glycerol gradient sedimentation followed by low-ionic-strength agarose gel electrophoresis. For each species of simian virus 40 chromosome purified, the comigrating DNA and proteins were identified by agarose or polyacrylamide gel electrophoresis, respectively. Two species of chromosomes were identified which contained form I and form II DNA and large amounts of viral protein; they migrated more slowly than most of the free simian virus 40 chromosomes, which contained very little viral protein. The nuclease susceptibility of these chromosomes suggests to us that they are intermediates in encapsidation, and we describe an encapsidation model.

Capsid↗