Biomedical subjects

B Rayner

Publications and source records attributed to B Rayner.

At least 55 records · Page 3Linked to original sources

PubMed1989

Comparative activity of alpha- and beta-anomeric oligonucleotides on rabbit beta globin synthesis: inhibitory effect of cap targeted alpha-oligonucleotides.

Alpha-anomeric oligonucleotides are resistant to nucleases and display parallel annealing to RNA complementary sequences. We compared the effect of alpha- and beta-oligonucleotides targeted against various mRNA regions on the rabbit beta globin in vitro synthesis. In order to determine the role of RNase H, experiments were performed in both rabbit reticulocyte lysate and wheat germ extract. As expected beta-oligonucleotides were found more efficient in wheat germ extract which is rich in RNase H activity and alpha-oligonucleotide targeted against the initiation codon or downstream had no effect because they do not induce mRNA cleavage by RNase H. However, we report, for the first time, a specific translation inhibition by alpha-oligonucleotides. This occurs provided they are targeted against the cap region in 5' of the mRNA.

Animals↗

PubMed1989

alpha-DNA X: alpha and beta tetrathymidilates covalently linked to oxazolopyridocarbazolium (OPC): comparative stabilization of oligo beta-[dT]:oligo beta-[dA] and oligo alpha-[dT]:oligo beta-[dA] duplexes by the intercalating agent.

The influence of the intercalating oxazolopyridocarbazolium (HOPC) on the stabilization of modified oligonucleotides: alpha-T4c5OPC or beta-T4c5OPC associated to beta-oligo (dA) was studied. It appears that the situation is different from what has been observed for the interaction of these modified oligonucleotides with poly (rA). The higher free energy of formation of the alpha-T4c5OPC :beta-oligo(dA), when compared to beta-T4c5OPC, is essentially due to the overall stability added to this system by the intercalator. This enhanced stability comes from a higher number of binding sites of HOPC for the alpha:beta duplex together with a lower van't Hoff energy of formation of the alpha:beta duplex.

Carbazoles↗

PubMed1989

Mechanism of cleavage of apurinic sites by 9-aminoellipticine.

We have studied the kinetics of breakage of apurinic (AP) sites by the intercalating agent 9-aminoellipticine using fluorimetric methods with single (ss)- and double (ds)-stranded apurinic DNA. In order to understand the chemical process, high performance liquid chromatography was used to follow the reaction kinetics with the apurinic oligonucleotide model T(AP)T. The unstable intermediate, which is responsible for the beta-elimination step, is a Schiff base resulting from the interaction of the amino group of the aromatic amine with the aldehyde function of the deoxyribose moiety (AP site). Fluorescence occurs simultaneously with the breakage of both ss and ds DNA and of the oligonucleotide and arises from the formation of a conjugated double bond on the Schiff base through the beta-elimination reaction. In optimal conditions, the second order rate constant for the fluorescence build up is 15 x 10(3) min-1 M-1 for ds DNA and 0.105 x 10(3) min-1 M-1 for T(AP)T. The ability of 9-aminoellipticine to induce fluorescence and breakage of ss DNA and T(AP)T shows that intercalation is not essential for this reaction to occur. Nevertheless, the greater rate constant with DNA suggests that stacking is an important parameter for the reaction of the aromatic amine with the AP site.

Alkaloids↗

PubMed1989

Alpha-DNA.IX: Parallel annealing of alpha-anomeric oligodeoxyribonucleotides to natural mRNA is required for interference in RNase H mediated hydrolysis and reverse transcription.

ps- and aps-alpha anomeric oligodeoxyribonucleotides were designed to recognize in parallel (ps) or antiparallel (aps) orientation two different sites of a 1000 base-long mRNA. Northern blots experiments indicate that only ps-alpha-oligonucleotides were able to hybridize to the mRNA target. Furthermore, only ps-alpha-oligonucleotides were able, in a sequence specific way, to protect the mRNA target against RNase H mediated hydrolysis or to inactivate the priming capacity of beta-oligodeoxynucleotide probes in reverse transcription. Formation of parallel-stranded mRNA alpha-oligonucleotide miniduplexes which prevents hybridization of beta-oligonucleotide probes is the most likely mechanism accounting for these results. Use of alpha-oligonucleotides as potential gene control agents is discussed.

Base Sequence↗

PubMed1989

Inhibition of Moloney murine leukemia virus reverse transcriptase by alpha-anomeric oligonucleotides.

After parallel hybridization to complementary template RNA, alpha-anomeric oligonucleotides are not primers for Moloney murine leukemia virus reverse transcriptase. As can be expected they are competitors of classical primer oligonucleotides (beta-anomeric). They therefore inhibit the RNA dependent DNA polymerase activity of Moloney murine leukemia virus reverse transcriptase with either homopolymeric or heteropolymeric substrates. Non complementary alpha-oligonucleotides display no inhibitory activity. alpha-Oligonucleotides are therefore potential candidates for inhibition of retroviral reverse transcriptases by interference with the primer binding sites.

Base Sequence↗

PubMed1989

Synthesis, DNA binding, and biological evaluation of synthetic precursors and novel analogues of netropsin.

A series of oligopeptides have been synthesized that are structurally related to the natural agent netropsin. The binding constants to double-stranded polynucleotides as well as the cytostatic activity against both murine human tumor cell lines and the in vitro activity against a range of DNA and RNA viruses have been determined for these novel compounds and some of their synthetic precursors. 1-Methyl-5-nitropyrrole-2-carboxylic acid methyl ester (4), N-[[1-methyl-4-(1-methyl-4-nitropyrrole-2-carboxamido)pyrrol-2- yl]carbonyl]-L-alanine tert-butyl ester (28), and N-[[1-methyl-4-(1-methyl-4-nitropyrrole-2-carboxamido)pyrrol-2- yl]carbonyl]-L-alanyl-L-alanine tert-butyl ester (29) showed modest inhibitory effect on tumor cell proliferation (CD50 = 26-85 micrograms/mL). Of all the compounds that were evaluated, 28 proved the most potent antiviral agent. It was inhibitory to parainfluenza-3 virus and Coxsackie virus B4 in Vero cells at a concentration of 20 micrograms/mL.

Animals↗

PubMed1989

[In vitro anti-HIV activity of phosphorothioate alpha-anomeric oligodeoxynucleotides].

Oligonucleotide analogs consisting exclusively of alpha-anomeric deoxynucleoside units bridged with phosphorothioate linkages have been synthesized and tested in vitro as antiviral agents against human immunodeficiency virus (HIV) in human T cells. Two 28-mers, an homopolymer alpha-S-dC28 and an oligomer alpha-S-anti-rev complementary to the initiation site of the regulatory viral gene rev exhibited antiviral activities comparable to those reported for the corresponding beta-anomeric phosphorothioate analogs. In contrast, a nuclease-resistant homopolymer, alpha-dC28 was inactive. Their preliminary results would indicate that the origin of oligonucleotide phosphorothioate anti-HIV activity is not exclusively correlated with their higher nuclease resistance.

Base Sequence↗

PubMed1988

Antiviral activity of conjugates between poly(L-lysine) and synthetic oligodeoxyribonucleotides.

Short (14 to 20-mer range) synthetic oligodeoxyribonucleotides (oligos) allow to modulate specifically viral or cellular gene expression at various stages thus providing a versatile tool for fundamental studies and a rational approach to antiviral chemotherapy. Several problems, such as metabolic stability and efficient cell internalization of oligos, still limit this approach appreciably, as briefly discussed here. We demonstrate here that the conjugation of 15-mer (beta)-anomeric oligos to poly(L-lysine) allows a specific protection of various cell lines against vesicular stomatitis virus infection at concentrations lower than 1 microM. This can be achieved with oligos complementary to the viral N-protein mRNA initiation site or to viral intergenic sequences, i.e., to untranscribed regions. No antiviral activity can be obtained with (alpha)-anomeric oligos directed against the same targets, although such analogues are much more resistant to nuclease degradation and form stable hybrids, at least in cell-free experiments.

Animals↗

PubMed1988

Alpha-anomeric DNA: beta-RNA hybrids as new synthetic inhibitors of Escherichia coli RNase H, Drosophila embryo RNase H and M-MLV reverse transcriptase.

Nuclease-resistant alpha-anomeric DNA:beta-RNA hybrids are inhibitors of Escherichia coli RNase H, and Drosophila embryo RNase H. RNase H activities were measured by polyacrylamide gel electrophoresis, employing a short substrate, (A)12:d[G-G-(T)12-G-G], or by acid-solubility techniques, using a long substrate, poly(A):poly(dT). Strand exchanges which could be responsible for the observed inhibition have been ruled out by S1 nuclease experiments and by using inhibitors which do not allow strand exchange. Our results suggest that RNase H, for which DNA:RNA duplexes are the natural substrates, binds to non-physiological alpha-DNA:RNA hybrids and is consequently inhibited. These hybrids also inhibit the RNA-dependent DNA polymerase activity of M-MLV reverse transcriptase, therefore appearing as potential inhibitors of at least two reverse transcriptase activities. However, the inhibitory effect of these hybrids with respect to M-MLV reverse transcriptase is also observed with the single-stranded alpha-DNA itself. Unexpectedly, polymerase activity is highly stimulated by alpha-oligos, analogous in their sequence to the beta primer used at a concentration unable to generate a detectable synthesis. These results suggest that the inhibition of reverse transcriptase activity with the alpha:beta may occur at different levels.

Animals↗

PubMed1988

Efficient and easy synthesis of octathymidylate covalently linked to intercalating 9-aminoellipticine.

Reductive amination of 3'-apurinic octathymidylate with 9-aminoellipticine provides octathymidylate covalently linked to intercalating ellipticine through a 3,4-dihydroxypentamethylene linker. Studies of its binding properties to poly(rA) reveals the formation of two different complexes depending of the temperature (Tm 13 degrees C and 38 degrees C) with dT/rA stoichiometry respectively equal to 2/1 and 1/1. When compared to parent octathymidylate, stability of the latter duplex is enhanced by the interaction energy provided by the dye moiety.

Alkaloids↗

PubMed1988

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

Base Sequence↗

PubMed1988

alpha-Oligodeoxynucleotide stability in serum, subcellular extracts and culture media.

Degradation of a synthetic alpha-oligodeoxynucleotide was studied in order to compare its survival with naturally occurring beta-oligodeoxynucleotides in five systems used for antisense hybridization arrest experiments. In contrast to beta-oligodeoxynucleotides, alpha-oligodeoxynucleotides were not detectably degraded over 24 h at 37 degrees C in HeLa cell postmitochondrial cytoplasmic extract or RPMI 1640 with 10% fetal bovine serum, and showed significant survival after 24 h at 37 degrees C in rabbit reticulocyte lysate, fetal bovine serum and human serum.

Base Sequence↗

PubMed1987

alpha-DNA. VI: Comparative study of alpha- and beta-anomeric oligodeoxyribonucleotides in hybridization to mRNA and in cell free translation inhibition.

alpha and beta-anomeric d(G2T12G2) oligodeoxyribonucleotides were compared for their hybridization to rA12: the observed melting temperatures are 27 degrees C for beta-oligodeoxyribonucleotide/RNA hybrid and 53 degrees C for alpha-oligodeoxyribonucleotide/RNA. alpha-oligonucleotides with the four bases, complementary to natural mRNAs, were synthesized for the first time, labeled at their 5'-end with [32P] and used as probes in Northern blot experiments. In spite of these higher affinities for their target RNA's, they were unable to block translation of natural or synthetic mRNA's in rabbit reticulocyte lysate. We have studied the RNase H activity on model rA12:alpha- or beta-d(G2T12G2) hybrids or on mRNA:alpha- or beta-oligonucleotides hybrids. Specific hybridization protects RNA strech when using alpha-oligonucleotides but not beta-oligonucleotides. Thus, our results show the inability of RNase H to degrade RNA in alpha-oligodeoxyribonucleotides:RNA duplexes.

Endoribonucleases↗

PubMed1987

alpha-DNA-V. Parallel annealing, handedness and conformation of the duplex of the unnatural alpha-hexadeoxyribonucleotide alpha-[d(CpApTpGpCpG)] with its beta-complement beta-[d(GpTpApCpGpC)] deduced from high field 1H-NMR.

The beta-complementary hexamer, beta-d[GTACGC], to the alpha-sequence, alpha-d[CATGCG], was synthesized by the phosphotriester method. The non-exchangeable proton assignments were obtained using 1D- and 2D-NMR techniques, including NOE, COSY and NOESY. The beta-strand exists as a random coil at 21 degrees C; however, at 4 degrees C, it forms an antiparallel self-recognition duplex annealing at positions 1-4. The beta-strand was annealed to the alpha-strand, and confirmation of complete annealing was obtained by detection and assignment of the six base pair imino protons in H2O/D2O solution at 21 degrees C. 1D-NOE experiments of the alpha, beta duplex d[alpha-(CATGCG) X beta-(GTACGC)] reveal that (i) it exists in aqueous solution in a conformation that belongs to the B family, (ii) it is 70 +/- 10% right-handed, (iii) the sugar-base orientations of the beta-strand are anti, and the deoxyribose units exist predominantly in the 2'-endo-3'-exo conformation. NOE measurements of the imino proton signals in the alpha, beta duplex reveal that the duplex exhibits parallel polarity.

Base Composition↗

PubMed1987

Alpha-DNA. IV: Alpha-anomeric and beta-anomeric tetrathymidylates covalently linked to intercalating oxazolopyridocarbazole. Synthesis, physicochemical properties and poly (rA) binding.

A new set of molecules made of an intercalating agent (oxazolopyridocarbazole, OPC) covalently linked through a polymethylene chain of various length to the 3' end of alpha-anomeric or beta-anomeric tetradeoxynucleotides (alpha- or beta-T4) have been synthesized. The beta-thymidylate modified compound (beta-T4C5OPC) is able to interact with the complementary sequence, beta-poly (rA); this interaction is strongly stabilized compared to the parent compound, beta-oligo(dT)4 and is specific for poly (rA). The molecule synthesized from the unnatural alpha-anomer, alpha-T4C5OPC, is also able to interact with poly (rA) leading to the formation of an alpha-beta hybrid stabilized by the energy provided by the OPC moiety. The stoechiometry of the binding reaction shows that an A-T pairing occurs in the alpha-beta heterohybrids. Tm studies reveal that the alpha-beta heterohybrids are more stable than their beta-beta counterparts.

Base Sequence↗

PubMed1987

alpha-DNA-III. Characterization by high field 1H-NMR, anti-parallel self-recognition and conformation of the unnatural hexadeoxyribonucleotides alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)]. Alpha-oligodeoxynucleotides as potential cellular probes for gene control.

High field 2-D-1H-NMR techniques permitted the assignment of all non-exchangeable protons of the unnatural deoxyribonucleotides alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)]. 1-D and 2-D NOESY experiments show strong H6H8-H4' dipolar interactions for all nucleotides in both sequences. These data, together with COSY and J-resolved spectra, indicate that these two alpha-oligomers adopt 3'-exo conformations of the sugar moieties in solution with anti conformations of the glycosyl linkages. Both 1H-NMR data, and hypochromocity comparison of alpha-CATGCG and beta-CATGCG, demonstrate a higher degree of base stacking in the case of the alpha-sequence. The UV hyperchromicity at 260 nm, and symmetry considerations in the imino proton NMR experiments reveal antiparallel self-recognition and duplex annealing at positions 1-4 for alpha-[d(CATGCG)] and positions 3-6 for alpha-[d(CGCATG)]. The temperature variation of the imino proton NMR signals suggests that the hydrogen bonding in self-recognition is comparable in strength with that in a beta-DNA duplex, and NOE data are in accord with Watson-Crick rather than Hoogsteen base pairing.

Gene Expression Regulation↗

PubMed1987

alpha-DNA II. Synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides containing the four usual bases and study of their substrate activities for nucleases.

This paper describes for the first time the synthesis of alpha-oligonucleotides containing the four usual bases. Two unnatural hexadeoxyribonucleotides: alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)], consisting only of alpha-anomeric nucleotide units, were obtained by an improved phosphotriester method, in solution. Starting material was the four base-protected alpha-deoxyribonucleosides 3a-d. Pyrimidine alpha-deoxynucleosides 3a and 3b were prepared by self-anomerization reactions followed by selective deprotection of sugar hydroxyles, while the two purine alpha-deoxynucleosides 3c and 3d were prepared by glycosylation reactions. In the case of guanine alpha-nucleoside derivative a supplementary base-protecting group: N,N-diphenylcarbamoyl was introduced on O6-position in order to avoid side-reactions during oligonucleotide assembling. The hexadeoxynucleotide alpha-[d(CpApTpGpCpG)] was tested as substrate of selected endo- and exonucleases. In conditions where the natural corresponding beta-hexamer was completely degradated by nuclease S1 and calf spleen phosphodiesterase, the alpha-oligonucleotide remained almost intact.

Deoxyribonucleases↗

PubMed1987

Structure and conformation of the duplex consensus 5'-splice site d[(CpApGpGpTpApApGpT).(ApCpTpTpApCpCpTpG)] deduced from high field 1H-NMR of the non-exchangeable and imino protons.

The complementary consensus donor exon intron junction d(ApCpTpTpApCpCpTpG) has been synthesized by a solid phase procedure. The non-exchangeable proton assignments were obtained using one- and two-dimensional NMR techniques including NOE, COSY, NOESY and 1H-1H-INADEQUATE. The non self-complementary nonamer exists as a random coil form in aqueous buffer at 21 degrees C as evidenced by the temperature variable 1H-NMR and NOE measurements. The nonamer was annealed to the primary consensus donor junction d(CpApGpGpTpApApGpT) and confirmation of complete annealing was obtained by detection and assignment of base pair imino protons in D2O/H2O mixtures. Application of one- and two-dimensional NMR techniques permitted the complete assignment of all the non-exchangeable protons in the duplex nonamer. These data, together with determination of vicinal coupling constants in the individual deoxyribose moieties, permits the following conclusions on the structure and conformation of the consensus donor junction: (i) it exists in aqueous solution in a conformation that belongs to the B family (ii) the sugar-base orientations are anti (iii) the deoxyribose units exist predominantly in the S conformation (2'-endo-3'-exo) (iv) the contiguous A.T base pairs d[T(5)-A(6)-A(7)].d[T(12)-T(13)-A(14)], two positions removed downstream from the splice site (5'-CAG decreases GTAAGT-3'), are uniquely propeller twisted. The propeller twisting occurs in the region in which there is partial complementarity with the branch site splice signal TACTAAC. The cross-correlation rates were used to derive the interproton distances between adjacent AH2 protons of 4.00 A in the T(5)-A(6).T(13)-A(14) step and of 3.87 A in the A(6)-A(7).T(12)-T(13) step. This structural and conformational feature if carried over into the primary RNA transcripts may serve as a recognition signal for this critical site in the genome.

DNA↗