Biomedical subjects

B T Brinton

Publications and source records attributed to B T Brinton.

7 recordsLinked to original sources

PubMed1999

Kainate receptors are involved in synaptic plasticity.

The ability of synapses to modify their synaptic strength in response to activity is a fundamental property of the nervous system and may be an essential component of learning and memory. There are three classes of ionotropic glutamate receptor, namely NMDA (N-methyl-D-aspartate), AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole-4-propionic acid) and kainate receptors; critical roles in synaptic plasticity have been identified for two of these. Thus, at many synapses in the brain, transient activation of NMDA receptors leads to a persistent modification in the strength of synaptic transmission mediated by AMPA receptors. Here, to determine whether kainate receptors are involved in synaptic plasticity, we have used a new antagonist, LY382884 ((3S, 4aR, 6S, 8aR)-6-((4-carboxyphenyl)methyl-1,2,3,4,4a,5,6,7,8,8a-decahydro isoquinoline-3-carboxylic acid), which antagonizes kainate receptors at concentrations that do not affect AMPA or NMDA receptors. We find that LY382884 is a selective antagonist at neuronal kainate receptors containing the GluR5 subunit. It has no effect on long-term potentiation (LTP) that is dependent on NMDA receptors but prevents the induction of mossy fibre LTP, which is independent of NMDA receptors. Thus, kainate receptors can act as the induction trigger for long-term changes in synaptic transmission.

Animals↗

PubMed1996

Investigations on the mechanisms of methotrexate resistance in a cisplatin-resistant L1210 murine leukemia cell subline.

We report a murine leukemia cell variant (L1210/DDP), selected for cisplatin (DDP) resistance, to be cross-resistant to methotrexate (MTX). Cross-resistance of L1210 cells to DDP and MTX has been observed by others, and has also been recorded in P388 murine leukemia and SSC-25 human squamous carcinoma cells. We demonstrated that MTX resistance is not due to dihydrofolate reductase (DHFR) gene amplification, increased DHFR enzyme activity or decreased MTX binding to the target enzyme. Of the mechanisms commonly proposed for MTX resistance, only differences in transport were observed when comparing sensitive (L1210/0) and resistant (L1210/DDP) cells. Our results suggest that MTX resistance in L1210/DDP cells is due to altered methotrexate uptake.

Animals↗

PubMed1996

Transfection of a manganese-containing superoxide dismutase gene into hamster tracheal epithelial cells ameliorates asbestos-mediated cytotoxicity.

To determine if overexpression of manganese-containing SOD (MnSOD) alters cell sensitivity to asbestos, an expression cassette containing murine MnSOD cDNA was cotransfected with pSV2neo, a plasmid conferring resistance to the antibiotic G418, into a diploid cell line of hamster tracheal epithelial (HTE) cells. Pools of G418-resistant transfectants were characterized by Southern and Northern blot analyses and enzyme activity assays. Although increases in MnSOD gene copies in individual cell pools ranged from approximately 7- to 86-fold in comparison to cells transfected with pSV2neo alone, steady-state levels of MnSOD mRNA were increased only by 1.4-to 2.3-fold. Despite modest increases in MnSOD mRNA, significant elevations in MnSOD enzyme activity were observed in pools of G418-resistant cells. MnSOD-transfected cell lines were more resistant to the cytotoxic effects of crocidolite asbestos using a sensitive colony-forming efficiency (CFE) assay. These data show that MnSOD has a direct role in cell defense against asbestos-induced cytotoxicity, an oxidant-dependent process.

Animals↗

PubMed1995

Plasmid amplification-promoting sequences from the origin region of Chinese hamster dihydrofolate reductase gene do not promote position-independent chromosomal gene amplification.

Initiation of DNA synthesis occurs with high frequency at oribeta, a region of DNA from the amplified dihydrofolate reductase (DHFR) domain of Chinese hamster CHOC 400 cells that contains an origin of bidirectional DNA replication (OBR). Recently, sequences from DHFR oribeta/OBR were shown to stimulate amplification of cis-linked plasmid DNA when transfected into murine cells. To test the role of oribeta/OBR in chromosomal gene amplification, linearized plasmids containing these sequences linked to a DHFR expression cassette were introduced into DHFR- CHO DUKX cells. After selection for expression of DHFR, cell lines that contain a single integrated, unrearranged copy of the linearized expression plasmid were identified and exposed to low levels of the folate analog, methotrexate (MTX). Of seven clonal cell lines containing the vector control, three gained resistance to MTX by 5 to 15-fold amplification of the integrated marker gene. Of 16 clonal cell lines that contained oribeta/OBR linked to a DHFR mini-gene, only 6 gained resistance to MTX by gene amplification. Hence, sequences from the DHFR origin region that stimulate plasmid DNA amplification do not promote amplification of an integrated marker gene in all chromosomal contexts. In addition to showing that chromosomal position has a strong influence on the frequency of gene amplification, these studies suggest that the mechanism that mediates the experiment of episomal plasmid DNA does not contribute to the early steps of chromosomal gene amplification.

Animals↗

PubMed1993

The transactivator proteins VP16 and GAL4 bind replication factor A.

Many transcription factors can activate the initiation of DNA replication. We have used affinity chromatography to show that the acidic activation domains of the transcription factors VP16, GAL4, and p53 each bind selectively to human and yeast replication factor A (RPA). The binding is direct and to the largest subunit of the trimeric RPA complex, RPA-1. Mutations in VP16 that reduce the ability of GAL4-VP16 to activate polyomavirus DNA replication also compromise the binding of VP16 to RPA. We suggest that transcription factors may interact with RPA either to stabilize single-stranded DNA at a replication origin or to recruit DNA polymerase alpha to the replication initiation complex.

DNA-Binding Proteins↗

PubMed1991

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

Animals↗

PubMed1984

Assignment of tissue-type plasminogen activator to chromosome 8 in man and identification of a common restriction length polymorphism within the gene.

The plasminogen activators (PAs) are serine proteinases which convert the inactive proenzyme plasminogen into plasmin, a proteinase associated with processes such as fibrinolysis and tissue remodelling. There are two immunologically distinct types of PA: tissue-type (t-PA), the main form involved in thrombolysis, and urokinase-type (u-PA), primarily involved in tissue degradation. Two or possibly more genes encode PA activity, and one locus has been provisionally assigned to chromosome 6 in man. We have isolated cDNA clones which encompass the entire coding sequence of the t-PA gene, and have used these to probe DNA on Southern blots isolated from 18 independent human-rodent somatic cell hybrid lines. The presence of the human gene for t-PA showed complete concordance with human chromosome 8 in the hybrids. In addition, the cDNA clones recognize a restriction fragment length polymorphism, where the two common alleles each have a frequency of approximately 0.5. t-PA and u-PA activities have been found in a wide variety of malignant cells, where they are thought to play a role in metastatic invasion of normal tissue. The results reported here will enable us to investigate whether genetic changes associated with the chromosome encoding t-PA are associated with altered t-PA expression in neoplasia.

Chromosome Mapping↗