Biomedical subjects

C Azuma

Publications and source records attributed to C Azuma.

At least 19 recordsLinked to original sources

PubMed2001

DNA methylation of the human oxytocin receptor gene promoter regulates tissue-specific gene suppression.

In the human oxytocin receptor (OTR) gene, there is a CpG island from 140 bp upstream to 2338 bp downstream of the transcription start site (TSS). We investigated whether the methylation state of this region affects the transcription of the OTR gene. HepG2 derived from human hepatoblastoma, in which OTR gene transcription was suppressed, was treated with a demethylating agent, 5-azacytidine (Aza-C) for 2 days. Semiquantitative RT-PCR indicated that OTR mRNA was significantly increased by Aza-C treatment in a dose-dependent manner. We estimated the level of methylation within the CpG islands of the OTR gene in peripheral blood leukocytes, nonpregnant uterine myometrium, term uterine myometrium and liver. A 1.5-kb region located 5' upstream of the translation start site was divided into four fragments. Each was amplified by PCR after complete digestion with methylation-sensitive restriction enzyme HpaII. The amount of PCR products was largest in the liver, suggesting that this CpG island in the OTR gene is most highly methylated in liver, where the gene is always inactivated. We compared the effect of in vivo methylation of the CpG island on transcriptional activity of an OTR-reporter plasmid. The reporter gene activity of expression plasmid -2860/+1342-GL3, containing the CpG island, in HepG2 cells was suppressed to 30.6% of the control level after methylation with SssI methylase, while that of -2840/+144-GL3, without the CpG island was suppressed only to 81.4%. The deletion of the segment (MT2) where the level of methylation was most different between liver and uterus (-2860/+1342(del)MT2-GL3) rescued the suppression rate to 68.0%. These results indicate that the methylation of the CpG island in the human OTR gene promoter suppressed its transcription at least in liver and may regulate tissue specific gene expression among organs.

Azacitidine↗

PubMed2001

Effects of bezafibrate and simvastatin on plasma lipoproteins in hypercholesterolemia resistant to hormone replacement therapy.

OBJECTIVES: Estrogen replacement therapy has favorable effects on serum lipoprotein levels in postmenopausal women with hypercholesterolemia. However, there are some patients who fail to respond to hormone replacement therapy (HRT) to lower the serum cholesterol level. In these cases, a conventional lipid-lowering therapy will be applied in addition to HRT, while the effects of these drugs are not well understood. In this study, we studied the effects of simvastatin and bezafibrate administered in addition to HRT. METHODS: Patients who were hypercholesterolemic even after HRT were randomly assigned to three treatment groups: HRT only (control group, n=10), HRT+simvastatin (10 mg/day, n=10), or HRT+bezafibrate (400 mg/day, n=10). Serum lipids and lipoprotein levels were measured throughout 12 weeks. RESULTS: The serum triglyceride levels were decreased by 24+/-28 and 38+/-13% in the HRT+simvastatin and HRT+bezafibrate groups, respectively. HRT+simvastatin decreased the total cholesterol (21+/-10%) and low-density lipoprotein cholesterol (28+/-12%) levels without affecting the high-density lipoprotein cholesterol (HDL-C) level, while HRT+bezafibrate increased the HDL-C level (12+/-11%). CONCLUSIONS: Treatment with simvastatin or bezafibrate in addition to HRT should be considered in cases of postmenopausal hypercholesterolemia in which HRT alone fails to lower the serum lipoprotein levels.

Bezafibrate↗

PubMed2001

Production of secretory leukocyte protease inhibitor by human amniotic membranes and regulation of its concentration in amniotic fluid.

Secretory leukocyte protease inhibitor (SLPI) is a potent inhibitor of human leukocyte elastase. SLPI is a protein found in various human fluids, including parotid secretions, cervical mucus, seminal plasma and ascites. Western blot analysis revealed that SLPI protein is detected as a 12 kDa band in both the amniotic fluid and the amniotic membrane. The amniotic fluid concentrations of SLPI were assayed by enzyme-linked immunosorbent assay. SLPI concentrations in the amniotic fluid of women in the third trimester were higher than those in the second trimester. Immunohistochemistry using an anti-SLPI polyclonal antibody revealed positive staining in epithelial cells in amniotic membranes. Reverse transcription-polymerase chain reaction demonstrated that SLPI transcripts could be detected in the amniotic membranes. To determine the mechanism of SLPI production by amniotic cells, purified amniotic cells were stimulated with various cytokines. Amniotic cells produced SLPI in a dose-dependent manner when stimulated with interleukin (IL)-1alpha, IL-1beta, and tumour necrosis factor-alpha. The present findings show that SLPI is produced by the amniotic membranes in response to cytokine concentrations. The SLPI in the amniotic fluid may contribute to immunodefence mechanisms during pregnancy.

Amniotic Fluid↗

PubMed2001

Calcium and phosphorus in aged human cerebral arteries.

To elucidate the compositional changes of the cerebral arteries with aging, the authors investigated age-related changes of the calcium and phosphorus contents in the cerebral arteries by inductively coupled plasma-atomic emission spectrometry. The subjects consisted of 11 men and 5 women, ranging in age from 52 to 96 yr. The anterior, middle, and posterior cerebral arteries derived from the same subjects were used in the present study. It was found that there were no significant relationships between age and calcium or phosphorus content in the anterior, middle, and posterior cerebral arteries, indicating that the accumulation of calcium and phosphorus scarcely occurred in the anterior, middle, and posterior cerebral arteries with aging. It was examined whether there were relationships in the calcium and phosphorus contents among the anterior, middle, and posterior cerebral arteries, It was found that there was a significant relationship in both the contents of calcium and phosphorus between the middle and posterior cerebral arteries, but not between the anterior and middle cerebral arteries nor between the anterior and posterior cerebral arteries.

Age Factors↗

PubMed2001

Accumulation of calcium and phosphorus accompanied by increase of magnesium and decrease of sulfur in human arteries.

To elucidate the accumulation of elements in the arteries with aging, the authors investigated age-related changes of elements in human arteries, such as the thoracic aorta, femoral, basilar, coronary, radial, and common iliac arteries by inductively coupled plasma-atomic emission spectrometry. The subjects consisted of 17 men and 9 women, ranging in age from 55 to 92 yr in the cases of the five arteries, except for the common iliac arteries, in which the subjects consisted of 16 men and 8 women, ranging in age from 65 to 93 yr. It was found that there were significantly direct correlations between calcium and phosphorus contents and between calcium and magnesium contents in all of the six arteries: thoracic aorta, femoral, basilar, coronary, radial, and common iliac arteries. Significantly direct correlations were also found between phosphorus and magnesium contents in the five arteries, except for the basilar artery. In contrast, significantly inverse correlations were found between calcium and sulfur contents and between phosphorus and sulfur contents in the four arteries, except for the coronary and radial arteries. These revealed that the accumulation of calcium and phosphorus in the arteries was accompanied by an increase of magnesium in the arteries and by a decrease of sulfur in the arteries.

Aged↗

PubMed2001

Simultaneous accumulation of calcium, phosphorus, and magnesium in various human arteries.

To elucidate compositional changes of the arteries with aging, the authors investigated the relationships among average contents of calcium, phosphorus, sulfur, and magnesium in the arteries by inductively coupled plasma-atomic emission spectrometry. The arteries used were the thoracic and abdominal aortas, coronary, common carotid, anterior, middle and posterior cerebral, vertebral, basilar, internal thoracic, axillary, radial, truncus celiacus, common, internal and external iliac, femoral, popliteal, and umbilical arteries. It was found that high correlations were found between the average contents of calcium and phosphorus, between the average contents of calcium and magnesium, and between the average contents of phosphorus and magnesium in the arteries, but not between the average contents of sulfur and the other elements. These correlations revealed that as the content of calcium and phosphorus increased in the arteries, the magnesium content increased simultaneously in the arteries, but the sulfur content did not. It is likely that magnesium forms compounds with phosphorus in the arteries.

Adult↗

PubMed2001

Relationships among element contents in the intimal, middle, and external tunicae of the thoracic aorta.

To examine an accumulation of elements within the arteries with aging, the authors investigated the element contents in the intimal, middle, and external tunicae of the thoracic aorta. The subjects consisted of six men and four women, ranging in age from 57 to 99 yr. The wall of the thoracic aorta was separated into the intimal, middle, and external tunicae by scrubbing the wall of the thoracic aorta with an edge of slide glass and the element contents were determined by inductively coupled plasma-atomic emission spectrometry. It was found that there were significant relationships among calcium, phosphorus, magnesium, sulfur, and sodium in both the intimal and middle tunicae of the aorta, but not in the external tunica. These results revealed that no significant differences were found in element compositions of deposits between the intimal and middle tunicae.

Aged↗

PubMed2001

Simultaneous accumulation of magnesium with calcium and phosphorus in aorta and iliac arteries of Thai.

To elucidate compositional changes of arteries with aging, the authors previously investigated age-related changes of mineral contents in the various arteries of Japanese and Japanese monkey. To examine whether there were differences between races in regard to age-related changes of mineral contents and the relationships among element contents in the arteries, the authors investigated the arteries of Thai. The subjects consisted of 13 men and 3 women, ranging in age from 39 to 84 yr. After the ordinary dissection at Chiang Mai University was finished, abdominal aortas, common iliac, internal iliac, and external iliac arteries were resected and the element contents were determined by inductively coupled plasma-atomic emission spectrometry. The contents of calcium, phosphorus, and magnesium became the highest in the fifties in the abdominal aorta, common iliac, and external iliac arteries, whereas the contents of calcium and magnesium became the highest in the sixties in the internal iliac artery, and decreased thereafter. In regard to relationships among element contents, it was found that there were high correlations between calcium and phosphorus contents, between calcium and magnesium contents, and between phosphorus and magnesium in all of the abdominal aortas and three iliac arteries. The mass ratios of magnesium to calcium and phosphorus were each similar in the abdominal aorta, common iliac, and internal iliac arteries, except for the external iliac artery, in which it was slightly high. These revealed that as calcium and phosphorus increased in the arteries with aging, magnesium increased in the arteries as well. The differences between the arteries of Thai and Japanese were discussed in the present article.

Adult↗

PubMed2001

Quantitative changes of calcium, phosphorus, and magnesium in common iliac arteries with aging.

To elucidate the mechanism of element accumulations in the arteries with aging, the authors investigated the mass ratios among calcium, phosphorus, and magnesium in the common iliac arteries by inductively coupled plasma-atomic emission spectrometry. The subjects consisted of 16 men and 8 women, ranging in age from 65 to 93 yr. It was found that there were extremely significant correlations between calcium and phosphorus contents, between calcium and magnesium contents, and between phosphorus and magnesium contents in the common iliac arteries. In regard to the mass ratio, although the mass ratio of calcium to phosphorus was almost constant, the mass ratios of magnesium to calcium and phosphorus were different at early and advanced stages of the accumulation of calcium and phosphorus. It was found that both the mass ratios of magnesium to calcium and phosphorus were higher at an early stage of the accumulation of calcium and phosphorus in the arteries than at an advanced stage of the accumulation.

Aged↗

PubMed2000

Isolation and characterization of a novel TP53-inducible gene, TP53TG5, which suppresses growth and shows cell cycle-dependent transition of expression.

Through a strategy of direct cloning of TP53-binding DNA sequences from human genome DNA, we have identified a novel TP53-target gene, termed TP53TG5 (TP53-target gene 5). This gene, localized to chromosome band 20q13.1 by fluorescence in situ hybridization, encodes a 290-amino-acid peptide with no significant homology with any known proteins in the public database. A colony-formation assay using human glioblastoma cell line T98G, which lacks wild-type TP53 and expresses no endogenous TP53TG5, revealed a growth-suppressive effect of the TP53TG5 gene product. Furthermore, immunohistochemical studies, following transfection of T98G with plasmid designed to express green fluorescent protein-fused TP53TG5, revealed cell cycle-dependent intracellular localization of this protein. Our results suggest that functional studies of TP53TG5 may provide new insights into the complex physiological activities of TP53.

Adaptor Proteins, Signal Transducing↗

PubMed2000

Elevations of group II phospholipase A2 concentrations in serum and amniotic fluid in association with preterm labor.

OBJECTIVE: The purpose of this study was to determine whether the elevation of secretory group II phospholipase A(2) concentration in the serum and amniotic fluid in preterm labor is associated with intrauterine inflammation. STUDY DESIGN: Serum and amniotic fluid were collected from women with preterm delivery (<37 weeks' gestation; n = 38) and term delivery (n = 20). Phospholipase activity was measured with a highly sensitive system that was based on reverse-phase high-performance liquid chromatographic separation of 9-anthracenylmethyl derivatives of fatty acids released by phospholipase A(2). The concentrations of immunoreactive isozymes (group I or II) of secretory phospholipase A(2) were assayed with a radioimmunoassay kit with a monoclonal antibody against human pancreatic phospholipase A(2) and splenic IIA phospholipase A(2). Localization of immunoreactive group II phospholipase A(2) in the amniotic membrane was determined by immunostaining visualized with the Vectastain ABC (Vector Laboratories, Inc, Burlingame, Calif) method. RESULTS: Enzymatic activities of phospholipase A(2) in the serum and amniotic fluid specimens obtained from patients in preterm labor with chorioamnionitis were significantly higher than those in specimens from patients in term labor. Significant elevations of phospholipase A(2) activities were observed in patients with preterm labor without histologically evident chorioamnionitis. The activity of phospholipase A(2) was clearly correlated with the concentration of the immunoreactive group II phospholipase A(2). Group II phospholipase A(2) was localized in amniotic cells obtained from patients with a pathologically determined diagnosis of chorioamnionitis. The predictive value for chorioamnionitis of the group II phospholipase A(2) concentration was relatively higher than the predictive values of the concentrations of C-reactive protein and interleukins 6 and 8. CONCLUSION: Significant elevations of group II phospholipase A(2) concentrations were detected in the serum and amniotic fluid of women with preterm labor. Group II phospholipase A(2) concentration may be a useful indicator for preterm labor, and phospholipid metabolism is certainly activated both in preterm labor and in apparent inflammatory diseases.

Amniotic Fluid↗

PubMed2000

Oncostatin M is produced during pregnancy by decidual cells and stimulates the release of HCG.

Oncostatin M (OSM) is a member of the interleukin-6 superfamily and a multifunctional cytokine that effects the growth and differentiation of many different cell types. OSM concentrations in the sera of pregnant women were found to be significantly higher than those of non-pregnant women. Western blot analysis revealed that the OSM protein was present in the decidua and chorionic tissue in each trimester. Throughout pregnancy, the amount of the OSM protein in the decidua was larger than that in the chorionic tissue. Immunohistochemistry using an anti-OSM monoclonal antibody demonstrated that OSM was mainly localized in the decidual glands and stroma. OSM transcripts in the decidua and the chorionic tissue were detected during each trimester by reverse transcription-polymerase chain reaction (RT-PCR). The regulation of human chorionic gonadotrophin (HCG) release by the placenta in first trimester stimulated with recombinant OSM was also investigated. Stimulation of the placenta by OSM augmented HCG release in a time- and dose-dependent manner. HCG release induced by recombinant human OSM was completely blocked by antibodies against OSM and the signal transducer, gp130, but only partially inhibited by antibodies against the leukaemia inhibiting factor (LIF) receptor. These results suggest that OSM molecules produced by decidual glands and stromal cells during pregnancy have an important role in placental endocrine function.

Antibodies, Monoclonal↗

PubMed2000

Increased concentrations of secretory leukocyte protease inhibitor in peritoneal fluid of women with endometriosis.

Secretory leukocyte protease inhibitor (SLPI) is a potent inhibitor of human leukocyte elastase. We investigated whether SLPI was present in the peritoneal fluid of women with endometriosis and to clarify the role of SLPI in the pathogenesis of endometriosis. Western blot analyses revealed that SLPI protein was detected as a 12 kDa band in peritoneal fluid. The peritoneal fluid concentrations of SLPI, elastase and interleukin-6 were assayed by enzyme-linked immunosorbent assays (ELISA). SLPI concentrations and the SLPI/elastase ratio in the peritoneal fluid of women with endometriosis were higher than in samples from women without endometriosis. There was no significant correlation between concentrations of SLPI and interleukin-6 in the peritoneal fluid. Immunohistochemistry using an anti-SLPI polyclonal antibody revealed positive staining in peritoneal macrophages, but not lymphocytes. The present findings suggest that SLPI found in the peritoneal fluid of patients with endometriosis may contribute to the pathogenesis of endometriosis.

Adult↗

PubMed2000

Hyperthermia increases accumulation of technetium-99m-labeled liposomes in feline sarcomas.

The effect of hyperthermia on the accumulation of technetium-99m-labeled liposomes was studied in feline sarcomas. Each cat received two separate injections of liposomes. The first was used to quantify the amount of technetium-99m-labeled liposomes within the tumor under normothermic conditions. The second injection was made at the beginning of a 60-min hyperthermia procedure. Planar scintigraphy was used to measure the activity of technetium-99m-labeled liposomes within the tumor at predetermined times up to 18 h after injection. Regions of interest were drawn for the tumor, lungs, liver, kidney, and aorta. Counts in the regions of interest were decay corrected. Counts/pixel in the tumor under normothermic and hyperthermic conditions were normalized to aorta counts/pixel. A total of 16 cats were eligible for the study. In two of the 16 cats, incomplete count data precluded analysis. In the remaining 14 cats, hyperthermia resulted in a significant increase in liposome accumulation in the tumor (P = 0.001). Tumor volume ranged from 1.2 to 236.2 cm3, and thermal dose ranged from 2.0 to 243.3 CEM43CT90 (equivalent time that the 10th percentile temperature was equal to 43 degrees C). There was not a relationship between either tumor volume or hyperthermia dose on the magnitude of increased liposome accumulation, suggesting that this method has application across a range of tumor volumes and degrees of heatibility.

Animals↗

PubMed1999

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Amino Acid Sequence↗

PubMed1999

Two-color fluorescence staining of lectin and anti-CD46 antibody to assess acrosomal status.

OBJECTIVE: To examine potential methods for distinguishing between the acrosome reaction and acrosomal loss. DESIGN: Prospective randomized study. SETTING: Department of Obstetrics and Gynecology, Osaka University Hospital, Suita, Japan. PATIENT(S): Five healthy volunteers and 34 patients with normozoospermia who were participating in an IVF program. INTERVENTION(S): Semen samples were collected from the volunteers before the hamster egg penetration assay and from the patients at the time of IVF. MAIN OUTCOME MEASURE(S): The numbers of oocytes penetrated and spermatozoa bound were determined with the hamster egg penetration assay. Acrosomal status was assessed with two-color fluorescence staining using fluorescein isothiocyanate-conjugated Pisum sativum agglutinin (FITC-PSA) and MH61 (anti-CD46 monoclonal antibody) with Texas red-conjugated antimouse immunoglobulin G antiserum. RESULT(S): The MH61 monoclonal antibody inhibited the penetration of human spermatozoa into hamster oocytes but did not reduce the number of spermatozoa bound to the zona-free hamster oocytes. Two-color fluorescence staining revealed four staining patterns of the acrosomal region. The percentage of PSA-negative/CD46-positive spermatozoa increased to a greater extent than that of PSA-negative/CD46-negative spermatozoa with an increase in the incubation time. CONCLUSION(S): Two-color fluorescence staining with FITC-PSA and the anti-CD46 monoclonal antibody may be useful for distinguishing between the acrosome reaction and acrosomal loss.

Acrosome↗

PubMed1999

The factor V Leiden mutation in Japanese couples with recurrent spontaneous abortion.

Thrombosis of placental vessels can be a major cause of recurrent spontaneous abortion (RSA). The factor V Leiden (FVL) mutation, a single point mutation in the factor V gene, is the most common genetic predisposition to thrombosis in European countries and the United States. However, even among Caucasian populations, the association between the FVL mutation and RSA is still controversial. The objectives of the present study were to investigate the prevalence of the FVL mutation in Japanese women who have experienced RSA and to clarify the contribution of the FVL mutation to recurrent miscarriages. A total of 52 Japanese women with a history of three or more consecutive idiopathic first trimester miscarriages and 41 of their male partners were studied. The control group consisted of 55 parous women without obstetric complications. Peripheral blood cell DNA was examined for the presence of the FVL alleles by polymerase chain reaction with Mnl I restriction fragment length polymorphisms. None of the 52 women with RSA and the 41 partners carried the mutation. We also found no subject carrying the FVL alleles in the control group. These results suggest that the FVL alleles are not concentrated in women with RSA at least to clinically significant levels and that there is no apparent association between the FVL mutation and RSA in our Japanese population.

Abortion, Habitual↗

PubMed1999

Secretory leukocyte protease inhibitor (SLPI) concentrations in cervical mucus of women with normal menstrual cycle.

Secretory leukocyte protease inhibitor (SLPI) is a potent inhibitor of human leukocyte elastase. SLPI transcripts in the cervical tissue were detected during the menstrual cycle by reverse transcription-polymerase chain reaction (RT-PCR). Western blot analysis revealed that the intensity of SLPI protein in cervical tissue in the ovulatory phase was stronger than in other phases. Immunohistochemistry using an anti-SLPI polyclonal antibody revealed positive staining in the epithelial cells of the endocervix. Western blot analysis also revealed that SLPI protein was present in the cervical mucus. Again the intensity of SLPI protein in the ovulatory phase was stronger than that in the follicular phase. The SLPI concentrations and SLPI/elastase ratios in the cervical mucus of women in the ovulatory phase were significantly higher than in the follicular and luteal phases. The SLPI and elastase concentrations in the cervical mucus were positively correlated. No significant difference was found in the SLPI serum concentrations of women during the menstrual cycle. These results suggest that production of SLPI from cervical epithelial cells during the ovulatory phase may be important for protection from the effects of elastase.

Adult↗