PubMed Health⌕ Search

Biomedical subjects

C Hanson

Publications and source records attributed to C Hanson.

At least 37 records · Page 2Linked to original sources
PubMed2000

Cost-effectiveness of childhood immunization reminder/recall systems in urban private practices.

OBJECTIVE: To assess cost and cost-effectiveness of immunization reminder/recall systems in the private sector. METHODS: A manual postcard system (mail) was compared with a computer-based telephone system (autodialer) and control. Costs included time costs and the cost of equipment and supplies. The cost per child and the incremental cost of the intervention relative to control were computed. Cost-effectiveness ratios were computed for return visits and for immunizations delivered. RESULTS: The average cost per child was $2.28 for the mail group and $1.47 for the autodialer group. The incremental visit cost relative to the control was higher for the mail group ($9.52) than for the autodialer group ($3.48). The autodialer was more cost-effective in delivering immunizations: $4. 06 per extra immunization (autodialer) versus $12.82 (mail). CONCLUSIONS: Excluding start-up costs, the autodialer system was most cost-effective. Including autodialer equipment costs, the autodialer system is more cost-effective only for larger practices.

Cost-Benefit Analysis↗
PubMed2000

Effective tuberculosis control and health sector reforms in Kenya: challenges of an increasing tuberculosis burden and opportunities through reform.

During the period from 1980 to 1997, the annual number of new tuberculosis cases increased four-fold in Kenya, and had reached approximately 50,000 cases by 1998. During the same time period, the government per capita expenditure on health dropped from US$9.5 to US$3.5. Since 1983, Kenya has been decentralising financial responsibility and decision-making power to the districts. In addition, the late 1980s saw the introduction of cost-sharing schemes for most health services, excluding tuberculosis (TB) treatment. In the midst of these changes, a dual epidemic of TB and HIV/AIDS emerged, and is presently over-burdening the traditional public health system. In response, the National Leprosy and Tuberculosis Control Programme (NLTP) is seeking a wider network of service providers and new approaches to the prevention and treatment of TB in the country. The history of health sector reform in Kenya is summarised and the role of the NLTP in these reforms assessed. Recent approaches taken by the NLTP to sustain effective TB control, which draw on the environment of a changing and flexible health system, are expressed. Participation of the NLTP in components of health sector reform, particularly decentralisation, integration, financing through cost-sharing and public/private mix, are highlighted.

Acquired Immunodeficiency Syndrome↗
PubMed1999

Maternal levels of plasma human immunodeficiency virus type 1 RNA and the risk of perinatal transmission. Women and Infants Transmission Study Group.

BACKGROUND: The importance of plasma levels of human immunodeficiency virus type 1 (HIV-1) RNA in pregnant women in relation to the other factors known to influence the risk of transmission of infection to their infants is incompletely defined. We studied the relation of maternal plasma HIV-1 RNA levels to the risk of perinatal transmission and the timing of transmission. METHODS: We measured plasma HIV-1 RNA serially in 552 women with HIV-1 infection who had singleton pregnancies. The status of infection in their infants was assessed by culture of blood and further classified as early (if a culture of blood obtained within the first two days of life was positive) or late (if a culture of blood obtained in the first seven days of life was negative but subsequent cultures were positive). The rates of transmission at various levels of maternal plasma HIV-1 RNA were analyzed by tests for trend, with adjustment for covariates by stratification and logistic regression. RESULTS: Increasing geometric mean levels of plasma HIV-1 RNA were associated with increasing rates of transmission: the rate was 0 percent among women with less than 1000 copies per milliliter (0 of 57), 16.6 percent among women with 1000 to 10,000 copies per milliliter (32 of 193), 21.3 percent among women with 10,001 to 50,000 copies per milliliter (39 of 183), 30.9 percent among women with 50,001 to 100,000 copies per milliliter (17 of 55), and 40.6 percent among women with more than 100,000 copies per milliliter (26 of 64) (P<0.001). The treatment status of one woman was unknown. The highest rate of transmission was among women whose plasma HIV-1 RNA levels exceeded 100,000 copies per milliliter and who had not received zidovudine (19 of 30 women, 63.3 percent). Neither higher HIV-1 RNA levels early in pregnancy nor higher levels late in pregnancy were associated with the timing of infection in the infants. CONCLUSIONS: In pregnant women with HIV-1 infection the level of plasma HIV-1 RNA predicts the risk but not the timing of transmission of HIV-1 to their infants.

Adult↗
PubMed1999

The influence of karyotype on the auricle, otitis media and hearing in Turner syndrome.

The study has investigated the relationship between the chromosomal aberration and ear and/or hearing disorders in 115 girls/women with Turner syndrome (TS). A dose-response relationship was found between the karyotype and hearing function. Hearing deteriorated more rapidly with increasing age in TS women lacking the whole p-arm of chromosome X (i.e. monosomy 45,X, or isochromosome cases 46,X,i(Xq)) as compared to women having a partial deletion of the p-arm (structural deletions or mosaicism cases), who, in turn, had poorer hearing than a female random population sample (46,XX) (P<0.001). Moreover, TS subjects having total deletion of the p-arm were three times more likely to have auricular anomalies or conductive hearing loss due to otitis media than subjects with partial deletion (P<0. 05). The results support the hypothesis that lack of growth-regulating genes such as the short stature homeobox-containing gene (SHOX), which is located within the pseudo-autosomal region on the p-arm of the X chromosome, may increase the occurrence of auricular malformations and otitis media and also induce an earlier loss of hearing function. Accordingly, the ear and hearing disorders in TS may be a result of growth disturbances of the auricle, the mastoid, the Eustachian tube and the organ of Corti during development. It is suggested that karyotype may be used as a predictor for future ear and hearing problems in TS.

Adolescent↗
PubMed1999

Diagnostic epididymal and testicular sperm recovery and genetic aspects in azoospermic men.

Various procedures for sperm recovery in azoospermic men have been described, from open testicular biopsy to simple needle aspiration from the epididymis and the testis. Fifty-one obstructive and 86 non-obstructive azoospermic men were treated to compare the recovery of spermatozoa obtained by percutaneous aspiration from the epididymis (PESA) and aspiration/extraction from the testis (TESA, TESE) with histopathology. If TESA failed, the work up proceeded with TESE. All patients were karyotyped. Spermatozoa were recovered by PESA or TESA in all obstructive men (51/51 patients). In 22 out of 86 patients with non-obstructive azoospermia, testicular spermatozoa could be successfully recovered by TESA. In five additional patients TESE was successful in recovering spermatozoa where TESA had failed. In 43 patients, neither TESA nor TESE was successful. Sixteen patients chose not to proceed with TESE. Seven out of 86 patients had an abnormal karyotype in the non-obstructive group (8%), none in the obstructive group. In the non-obstructive patient group testicular histopathology showed hypospermatogenesis, incomplete maturation arrest and germ cell aplasia with focal spermatogenesis in cases where spermatozoa were recovered and complete germ cell aplasia, complete maturation arrest and fibrosis in cases where no spermatozoa were found. Spermatozoa were recovered by PESA or TESA from all patients with obstructive azoospermia and from approximately 40% of patients with non-obstructive azoospermia by TESA or TESE. Retrieval of viable spermatozoa in the infertility work-up was highly predictable for sperm recovery in subsequent ICSI cycles. TESA performed under local anaesthesia seems almost as effective as more invasive procedures in recovering testicular spermatozoa, both in obstructive and non-obstructive azoospermic men.

Epididymis↗
PubMed1999

Sensitivity to extrinsically supplied interferon and the endogenous expression of interferon in melanoma cell lines.

Interferons (IFNs) have been shown to Induce loss of growth potential in melanoma cell lines. However, human melanomas have shown limited responsiveness to clinical therapy with IFN. In a previous study on melanoma cell lines we found that greatest sensitivity to IFN was found in cell lines with the greatest number of copies of chromosome 9p, where the IFN gene family is located. In the present study the expression In melanoma cell lines of IFN genes, IFN receptor genes and standard control genes (beta-actin, glyceraldehyde-3-phosphate dehydrogenase, 18S rRNA and cyclophilin) was investigated using the reverse transcription-polymerase chain reaction, together with an exogenous standard (cyclophllin armoured RNA). We found that the sensitivity to extrinsically supplied IFN seems to correlate with the expression of endogenous IFN genes. The two melanoma cell lines producing the highest relative amount of IFN mRNA transcripts also demonstrated the most marked response to extrinsically supplied IFN. We hypothesize that tumours with enhanced endogenous IFN production may respond more positively to IFN treatment.

Cell Division↗
PubMed1999

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

Child↗
PubMed1999

Attaining role confirmation in nurse practitioner practice.

Although nurse practitioners (NPs) as a collective group have reached the stage of role confirmation, in new settings they must transition through several phases of role development. The role confirmation issues for a team of NPs who were hired to work in a large academic teaching hospital in the Southeastern part of the United States are explored over a 3-year period. Characteristics of the organization and strategies that the NPs implemented over time impacted favorably on the evolution of the NP role in that setting. The NPs gained prescriptive privileges, independent practice, and market-place salaries. Effective negotiation and marketing strategies enhanced both personal and professional development.

Academic Medical Centers↗
PubMed1998

S-phase fraction related to prognosis in localised prostate cancer. No specific significance of chromosome 7 gain or deletion of 7q31.1.

A flow-cytometric (FCM) and fluorescence in situ hybridization (FISH) study was performed in 153 patients with clinically localised prostate cancer (PC) to evaluate retrospectively the prognostic significance of DNA ploidy, S-phase fraction (SPF) and chromosome 7 copy number. Deletions in 7q31.1 were analysed in a subset of 26 tumours. The mean follow-up time was 6 years (range 4-16 years). Twelve cases of benign prostatic hyperplasia (BPH) were studied as a control. Chromosome 7 enumeration and deletion studies were conducted using the alpha-satellite D7Z1 probe and a cosmid probe specific for the marker D7S522 on 7q31.1. Higher SPF was associated with shorter overall survival and shorter time to local progression and metastasis. Near diploid (DNA index 1.05-1.20) cases had a lower frequency of metastases and lower Gleason scores than aneuploid cases. Increased absolute chromosome 7 copy number (centromere count) was associated with higher Gleason score, higher SPF and shorter local progression-free and prostate cancer survival. Absolute chromosome 7 copy number was concordant with FCM DNA ploidy in the majority (75%) of cases. Relative gain or loss of chromosome 7 (centromere counts compared to ploidy) was infrequent, and no correlation was found with clinical parameters. Deletions in 7q31.1 were infrequent. Our results indicate that in localised PC (i) SPF is a prognostic factor, (ii) absolute chromosome 7 copy number is concordant with the ploidy status of the tumour (relative gain or loss of chromosome 7 is infrequent and has no independent prognostic value) and (iii) the frequency of deletions in 7q31.1 is low and not correlated with clinical outcome.

Adenocarcinoma↗
PubMed1998

Disease progression in a cohort of infants with vertically acquired HIV infection observed from birth: the Women and Infants Transmission Study (WITS).

BACKGROUND: The Women and Infants Transmission Study is an ongoing prospective cohort study of HIV-infected pregnant women and their infants. We used the 1994 U.S. Centers for Disease Control and Prevention (CDC) classification system for HIV infection in children to describe HIV disease progression in 128 HIV-infected children, and examined maternal and infant characteristics associated with disease course. METHODS: The Kaplan-Meier method was used to calculate probabilities of entry into CDC clinical classes A, B, and C (mild, moderate, and severe HIV disease); CDC immunologic stages 2 and 3; and death. Relative risks of progression for selected predictor events were estimated using the Cox proportional hazards model. RESULTS: With a median 24 months of follow-up, the median ages at entry into clinical classes A, B and C were 5, 11, and 48 months, respectively. Increased risk of progression to class C was seen in infants who had: onset of class B events (p < .001); progression to immunologic stage 2 (p < .001) or 3 (p < .001); early culture positivity (in first 48 hours, p < .01; in first 7 days, p = .03); and early appearance (within the first 3 months of life) of lymphadenopathy, hepatomegaly, or splenomegaly (p < .001). CONCLUSIONS: Reaching specific clinical or immunologic stages were strong predictors of progression to AIDS or death. Early onset of clinical signs (onset of lymphadenopathy, hepatomegaly, or splenomegaly < or =3 months of age), and early culture positivity (within the first 48 hours or within the first week of life), defined the infant with highest risk of disease progression.

Cohort Studies↗
PubMed1998

Conformation, stability, and active-site cysteine titrations of Escherichia coli D26A thioredoxin probed by Raman spectroscopy.

The active-site cysteines (Cys 32 and Cys 35) of Escherichia coli thioredoxin are oxidized to a disulfide bridge when the protein mediates substrate reduction. In reduced thioredoxin, Cys 32 and Cys 35 are characterized by abnormally low pKa values. A conserved side chain, Asp 26, which is sterically accessible to the active site, is also essential to oxidoreductase activity. pKa values governing cysteine thiol-thiolate equilibria in the mutant thioredoxin, D26A, have been determined by direct Raman spectrophotometric measurement of sulfhydryl ionizations. The results indicate that, in D26A thioredoxin, both sulfhydryls titrate with apparent pKa values of 7.5+/-0.2, close to values measured previously for wild-type thioredoxin. Sulfhydryl Raman markers of D26A and wild-type thioredoxin also exhibit similar band shapes, consistent with minimal differences in respective cysteine side-chain conformations and sulfhydryl interactions. The results imply that neither the Cys 32 nor Cys 35 SH donor is hydrogen bonded directly to Asp 26 in the wild-type protein. Additionally, the thioredoxin main-chain conformation is largely conserved with D26A mutation. Conversely, the mutation perturbs Raman bands diagnostic of tryptophan (Trp 28 and Trp 31) orientations and leads to differences in their pH dependencies, implying local conformational differences near the active site. We conclude that, although the carboxyl side chain of Asp 26 neither interacts directly with active-site cysteines nor is responsible for their abnormally low pKa values, the aspartate side chain may play a role in determining the conformation of the enzyme active site.

Binding Sites↗
PubMed1998

Lead consumption of 18- to 36-month-old children as determined from duplicate diet collections: nutrient intakes, blood lead levels, and effects on growth.

OBJECTIVE: To determine the amount of lead ingested in food by means of duplicate diet collections, nutrient intakes, and anthropometric measurements of young children. DESIGN: Once a month for a year, data were collected from 24-hour duplicate diets, hand wipes, a dust index, and anthropometric measurements. Quarterly, venous blood samples were obtained. Thermal ionization spectrometry by means of a lead-205 tracer was used to determine lead present in food, blood, and the hand wipes. A dust index was determined on the basis of observation of dust on surfaces in the home. Anthropometric measurements obtained were height, weight, head circumference, and mid-upper arm circumference. SUBJECTS/SETTING: Subjects were 21 children, aged 18 to 36 months, who resided in homes located in an urban area with potentially high lead levels. MAIN OUTCOMES MEASURED: Lead contamination in food and on hands, and blood lead values, were determined. STATISTICAL ANALYSIS PERFORMED: Pearson correlation coefficients were used to determine relationships between lead content in food, blood, and hand wipes and growth. Multiple regression analyses examined the effect of food types and dust lead on lead levels in food, and the effect of these variables on head circumference. RESULTS: Mean blood levels were 0.3089 +/- 0.1496 micromol/L; 12 samples contained more than 0.4826 micromol/L. Total intake of lead from food was 4.95 microg/day and ranged from 1.10 to -22.10 microg/day. More than a fourth of the diets collected exceeded 6.00 microg/day. Foods considered home prepared were moderately related to blood lead level, and the dust index and hand wipe lead levels were related to total food lead. Home-handled foods, canned foods, and hand-wipe lead were significant predictors of the lead content in food. A negative relationship was found between head circumference and blood lead level. APPLICATIONS: Level of lead in food was directly related to hand-wipe lead. This finding underscores the need for dietitians and other health professionals to stress the importance of cleanliness in environments that are potentially lead contaminated. Appropriate hand washing and surface cleaning should be emphasized when preparing and consuming food. The inverse relationship between head circumference and blood lead levels points to the need for additional studies to validate this finding while controlling for other extraneous variables.

Anthropometry↗
PubMed1998

Encephalopathy and progression of human immunodeficiency virus disease in a cohort of children with perinatally acquired human immunodeficiency virus infection. Women and Infants Transmission Study Group.

OBJECTIVE: To describe the incidence, predictors, and survival of children with human immunodeficiency virus (HIV) encephalopathy followed in the Women and Infants Transmission Study cohort. STUDY DESIGN: Retrospective review of clinical and immunologic staging of perinatally HIV-infected infants, based on the 1994 Centers for Disease Control and Prevention Classification System. RESULTS: Data were available for 128 HIV-infected children, with a median follow-up of 24 months. HIV encephalopathy was diagnosed in 27 (21%) of children. Median survival after diagnosis was 14 months. Of children with encephalopathy, 74% had at least moderate immunosuppression by the time of diagnosis. Encephalopathy represented the first acquired immunodeficiency syndrome-defining condition in 67%, and the only one in 26% of children. Hepatosplenomegaly or lymphadenopathy during the first 3 months of life was diagnosed in 63%, in contrast to 29% of those without encephalopathy (p value = 0.001). Cardiomyopathy was present in 30% of the children with encephalopathy versus 2% of those without encephalopathy. High viral load in infancy was associated with increased risk of encephalopathy but was not predictive of age at onset. CONCLUSIONS: Encephalopathy in children with HIV is common and is associated with high viral load, immunodeficiency, and shortened survival. Encephalopathy was more likely to develop in infants with early signs and symptoms of HIV, although age at onset could not be predicted.

AIDS Dementia Complex↗
PubMed1998

Effect of brushing with sonic and counterrotational toothbrushes on the bond strength of full veneer crowns.

STATEMENT OF PROBLEM: Earlier studies on orthodontic brackets have shown a loss of bond strength after a sonic toothbrush was used. PURPOSE: This in vitro study evaluated the difference in bond strength of single complete veneer crowns after being subjected to the equivalent of 2 years of brushing with sonic and counterrotational toothbrushes. MATERIAL AND METHODS: Complete gold crowns were fabricated with a conventional indirect technique for 30 extracted, intact, prepared human premolar teeth. Castings were then luted to the teeth with glass ionomer cement. Teeth were randomly divided into 3 groups of 10 teeth each, 1 group to be brushed with Sonicare sonic toothbrush, 1 group to be brushed with Interplak counterrotational mechanical toothbrush, and 1 group as the control. Groups 1 and 2 were then brushed for the equivalent of 2 years per tooth. A uniform force of 50 g for the sonic toothbrush and 120 g for the counterrotational toothbrush was used. Control specimens were not brushed. Brush heads and sample teeth in contact with the toothbrush were kept moist at all times. Tensile dislodgment force was determined with an Instron universal testing machine. RESULTS: The castings brushed with a sonic toothbrush required a mean of 43.22 kg (+/- 11.16) force to remove the crowns from the teeth, whereas the counterrotational group required a mean of 42.87 kg (+/- 10.42) and the control group a mean of 42.12 kg (+/- 6.61). Analysis of variance on the force data indicated no differences among the 3 groups in the force needed to remove the castings (F[2,24] = 0.031, P = .97). CONCLUSION: This in vitro study demonstrated no significant differences between groups in the amount of tensile dislodgment force required to remove cemented full veneer crowns from prepared teeth after brushing for the equivalent of 2 years time with a sonic toothbrush or a counterrotational toothbrush.

Analysis of Variance↗