PubMed Health⌕ Search

Biomedical subjects

C J Holmberg

Publications and source records attributed to C J Holmberg.

6 recordsLinked to original sources

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

Adjuvants, Immunologic↗

Diepitopic construct of functionally and epitopically complementary peptides enhances immunogenicity, reactivity with glucosyltransferase, and protection from dental caries.

Coimmunization with peptide constructs from catalytic (CAT) and glucan-binding (GLU) domains of glucosyltransferase (GTF) of mutans streptococci has resulted in enhanced levels of antibody to the CAT construct and to GTF. We designed and synthesized a diepitopic construct (CAT-GLU) containing two copies of both CAT (B epitope only) and GLU (B and T epitope) peptides. The immunogenicity of this diepitopic construct was compared with that of individual CAT and GLU constructs by immunizing groups of Sprague-Dawley rats subcutaneously in the salivary gland vicinity with the CAT-GLU, CAT, or GLU construct or by treating rats by sham immunization. Levels of serum immunoglobulin G (IgG) antibody to GTF or CAT in the CAT-GLU group were significantly greater than in GLU- or CAT-immunized groups. Immunization with CAT-GLU was compared to coimmunization with a mixture of CAT and GLU in a second rodent experiment under a similar protocol. CAT-GLU immunization resulted in serum IgG and salivary IgA responses to GTF and CAT which were greater than after coimmunization. Immunization with the diepitopic construct and communization with CAT and GLU constructs showed proliferation of T lymphocytes to GTF. Immunization with either the CAT or GLU construct has been shown to elicit significant protection in a rodent dental caries model. Similarly in this study, the enhanced response to GTF after immunization with the CAT-GLU construct resulted in protective effects on dental caries. Therefore, the CAT-GLU diepitopic construct can be a potentially important antigen for a caries vaccine, giving rise to greater immune response than after immunization with CAT, GLU, or a mixture of the two.

Amino Acid Sequence↗

Coimmunization with complementary glucosyltransferase peptides results in enhanced immunogenicity and protection against dental caries.

Peptide constructs from the catalytic (CAT) and glucan-binding (GLU) regions of the mutans streptococcal glucosyltransferase enzymes (GTF) can provide immunity to dental caries infection. A strategy of coimmunization was tested to determine whether protection could be enhanced. Rats were immunized with one of the previously described peptide constructs from the CAT or GLU region of the GTF of mutans streptococci or coimmunized with a combination of these constructs (CAT-GLU). Coimmunized animals demonstrated significantly higher serum immunoglobulin G (IgG) and salivary IgA antibody levels to CAT or GTF than rats immunized with either construct alone. To assess the functional significance of coimmunization with these constructs, animals were immunized as above or with Streptococcus sobrinus GTF and then infected with S. sobrinus to explore the effects of immunization on immunological, microbiological, and disease (dental caries) parameters. Serum antibody from the communized group inhibited S. sobrinus GTF-mediated insoluble glucan synthesis in vitro above that of the individual-construct-immunized groups. Immunization with CAT or GLU constructs resulted in significantly reduced dental caries after infection with S. sobrinus compared with sham-immunized animals. Coimmunization produced greater reductions in caries than after immunization with either CAT or GLU. Also, significant elevations in lymphocyte proliferative responses to CAT, GLU, and GTF were observed after coimmunization with CAT-GLU compared with the responses after immunization with the individual constructs. The results suggested that increased numbers of memory T cells, which could proliferate to CAT, were generated by coimmunization. The experiments support the functional significance of these GTF domains in dental caries pathogenesis and present coimmunization as a simple alternative to intact GTF to enhance protective immunity against cariogenic microorganisms.

Amino Acid Sequence↗

Immunization of rats with synthetic peptide constructs from the glucan-binding or catalytic region of mutans streptococcal glucosyltransferase protects against dental caries.

Previously, we have described peptide constructs from two regions of glucosyltransferase (GTF) of mutans streptococci. A putative catalytic site in the amino-terminal half of the molecule and a repeated glucan-binding site in the carboxyl-terminal half of GTF were the regions upon which sequences were based. The present study explored the effects of immunization with these peptide constructs (called CAT or GLU) and with streptococcal GTFs from Streptococcus sobrinus and S. mutans on immunological, microbiological, and disease parameters. Groups of immunized Sprague-Dawley rats were infected with either 10(8) S. sobrinus 6715 or 10(8) S. mutans SJ32 organisms. Serum immunoglobulin G antibody levels, determined by enzyme-linked immunosorbent assay, to the respective peptide constructs and to the appropriate streptococcal GTF were significantly increased (after immunization) prior to infection and at the end of the experiment. Also, serum antibody from CAT-, GLU-, and S. sobrinus GTF-immunized rats inhibited S. sobrinus GTF-mediated insoluble glucan synthesis (all) and S. mutans GTF-mediated soluble glucan synthesis (all except anti-GLU) from sucrose. Immunization with the CAT or GLU peptide construct resulted in significantly reduced smooth surface and sulcal caries after infection with S. sobrinus. Sulcal dental caries after infection with S. mutans SJ32 were also significantly reduced in CAT- and GLU-immunized rats. Thus, immunization with peptides whose sequences are based on putative functional domains of mutans streptococcal GTF are protective toward a cariogenic S. sobrinus or S. mutans infection.

Amino Acid Sequence↗