PubMed Health⌕ Search

Biomedical subjects

C Lau

Publications and source records attributed to C Lau.

At least 19 recordsLinked to original sources
PubMed2000

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.

3' Untranslated Regions↗
PubMed2000

Effects of physiologic pacing versus ventricular pacing on the risk of stroke and death due to cardiovascular causes. Canadian Trial of Physiologic Pacing Investigators.

BACKGROUND: Evidence suggests that physiologic pacing (dual-chamber or atrial) may be superior to single-chamber (ventricular) pacing because it is associated with lower risks of atrial fibrillation, stroke, and death. These benefits have not been evaluated in a large, randomized, controlled trial. METHODS: At 32 Canadian centers, patients without chronic atrial fibrillation who were scheduled for a first implantation of a pacemaker to treat symptomatic bradycardia were eligible for enrollment. We randomly assigned patients to receive either a ventricular pacemaker or a physiologic pacemaker and followed them for an average of three years. The primary outcome was stroke or death due to cardiovascular causes. Secondary outcomes were death from any cause, atrial fibrillation, and hospitalization for heart failure. RESULTS: A total of 1474 patients were randomly assigned to receive a ventricular pacemaker and 1094 to receive a physiologic pacemaker. The annual rate of stroke or death due to cardiovascular causes was 5.5 percent with ventricular pacing, as compared with 4.9 percent with physiologic pacing (reduction in relative risk, 9.4 percent; 95 percent confidence interval, -10.5 to 25.7 percent [the negative value indicates an increase in risk]; P=0.33). The annual rate of atrial fibrillation was significantly lower among the patients in the physiologic-pacing group (5.3 percent) than among those in the ventricular-pacing group (6.6 percent), for a reduction in relative risk of 18.0 percent (95 percent confidence interval, 0.3 to 32.6 percent; P=0.05). The effect on the rate of atrial fibrillation was not apparent until two years after implantation. The observed annual rates of death from all causes and of hospitalization for heart failure were lower among the patients with a physiologic pacemaker than among those with a ventricular pacemaker, but not significantly so (annual rates of death, 6.6 percent with ventricular pacing and 6.3 percent with physiologic pacing; annual rates of hospitalization for heart failure, 3.5 percent and 3.1 percent, respectively). There were significantly more perioperative complications with physiologic pacing than with ventricular pacing (9.0 percent vs. 3.8 percent, P<0.001). CONCLUSIONS: Physiologic pacing provides little benefit over ventricular pacing for the prevention of stroke or death due to cardiovascular causes.

Aged↗
PubMed2000

Glucocorticoid receptor regulation in the rat embryo: a potential site for developmental toxicity?

Glucocorticoids play a key role in controlling numerous cellular processes during embryogenesis and fetal development. Excess glucocorticoids during development have been linked to dysmorphogenesis and/or intrauterine growth impairment in rodents. The actions of glucocorticoids are mediated by interaction with their receptors. Negative feedback regulation of glucocorticoid receptor (GR) is important for limiting cellular sensitivity to the hormones. Hence, acute exposure of the adult rat to the synthetic glucocorticoid dexamethasone (DEX) reduced both GR mRNA and protein in a variety of tissues that include hippocampus and liver, in a dose- and time-dependent fashion. Reduction in GR mRNA and protein were observable when DEX was given repeatedly at doses as low as 0. 05 mg/kg. In the control whole rat embryo, GR mRNA was low but measurable at as early as gestational day (GD) 10, but underwent rapid ontogenetic increase in the ensuring days. In contrast to the adult, neither GR mRNA nor protein in the whole rat embryo was affected by acute or repeated DEX administration to pregnant rats on GD10-13, even at doses as high as 0.8 mg/kg. Similar results were obtained in embryonic palate and liver, tissues known to be glucocorticoid targets. These data suggest that GR autoregulation does not occur during organogenesis in the rat. Accordingly, hormonal elevations from stress or chemical insults can be transduced unrestrictedly, ultimately leading to aberrant cell function and development. The unique mode of GR regulation seen in the embryonic cells may provide a potential common mechanism for developmental perturbation and toxicity for a variety of insults.

Analysis of Variance↗
PubMed2000

Role of endothelium in thapsigargin-induced arterial responses in rat aorta.

We assessed the role of endothelium in the arterial response to thapsigargin, the Ca(2+)-ATPase inhibitor of the endoplasmic reticulum, in rat isolated aortic rings. Thapsigargin induced an endothelium-dependent relaxation of phenylephrine-contracted aortic rings with an EC(50) of 2.6+/-0.4 nM and a 75% maximum relaxation, while it was less effective against 30 mM K(+)-induced contraction. Pretreatment of aortic rings with N(G)-nitro-L-arginine methyl ester (30 microM) or methylene blue (1 microM) reduced thapsigargin-induced relaxation by approximately 85%. Thapsigargin failed to relax the endothelium-denuded rings. L-Arginine (3 mM) partially, but significantly, antagonized the effect of 30 microM N(G)-nitro-L-arginine methyl ester. Pretreatment with indomethacin (3 microM), glibenclamide (1 microM) or iberiotoxin (100 nM) did not alter the thapsigargin-induced relaxation. In contrast, pretreatment with tetrapentylammonium ions (TPA(+), 1-3 microM) or with 300 microM Ba(2+) suppressed the relaxant response to thapsigargin. TPA(+) (3 microM) also attenuated acetylcholine-induced relaxation. Thapsigargin-induced endothelium-dependent relaxation was primarily dependent on the presence of extracellular Ca(2+). Interestingly, when the tissues were exposed to very low concentrations of thapsigargin (1-3 nM) the nitric oxide-dependent relaxation induced by acetylcholine or A23187 was markedly reduced. While thapsigargin (3 nM) did not influence the relaxation induced by endothelium-independent dilators, sodium nitroprusside and verapamil. These results indicate that thapsigargin produced complex vascular effects primarily by acting on the endothelial cells. Thapsigargin causes an endothelial nitric oxide-dependent relaxation; on the other hand, it inhibits nitric oxide-mediated relaxation at the similar concentrations. Activation of TPA(+)- and Ba(2+)-sensitive but not Ca(2+)-activated or ATP-sensitive K(+) channels may be also involved in thapsigargin-induced relaxation of rat isolated aortic rings.

Animals↗
PubMed2000

A review of antimycobacterial natural products.

Tuberculosis is a chronic infectious disease caused by several species of mycobacteria. Due to multi-drug resistant strains of mycobacteria and to a high prevalence of tuberculosis in patients who have acquired human immunodeficiency syndrome (AIDS), the number of patients infected with the disease is increasing worldwide. Thus there is an urgent need for new effective antimycobacterial agents to replace those currently in use. In this instance, the plant kingdom is undoubtedly a valuable source for new anti-tuberculosis agents. The present review article reports the findings from an extensive literature search of all plants that have been assessed for antimycobacterial/antitubercular activity over the past 20-30 years. An attempt has been made to summarize the information in order to highlight those promising plant species which are worthy of further investigation as leads for drug development. Over 350 plant species from a wide range of families and origins, containing various chemical classes of compounds, have been screened for such activity. A review of the relevant in vitro assays using different species of pathogenic and non-pathogenic mycobacteria is also included.

Antitubercular Agents↗
PubMed2000

Evaluation of biologically based dose-response modeling for developmental toxicity: a workshop report.

Biologically based dose-response (BBDR) modeling represents a novel approach for quantitative assessment of health risk by incorporating pharmacokinetic and pharmacodynamic characteristics of a chemical and by relating the immediate cellular responses to a cascade of aberrant biological actions that leads to detectable adverse outcomes. The quantitative relationship of each of the intervening events can be described in mathematical forms that are amenable for adjustment and extrapolation over a range of doses and across species. A team of investigators at the Reproductive Toxicology Division of the U.S. Environmental Protection Agency has explored the feasibility of BBDR modeling by examining the developmental toxicity of a known teratogen, 5-fluorouracil. A panel of researchers from academic and industrial laboratories, biomathematical modelers, and risk assessment scientists was convened in a workshop to evaluate the approaches undertaken by the EPA team and to discuss the future prospects of BBDR modeling. This report summarizes the lessons learned from one approach to BBDR modeling and comments from the panelists: while it is possible to incorporate mechanistic information into quantitative dose-response models for the assessment of health risks, the process is enormously data-intensive and costly; in addition, the confidence of the model is directly proportional to our current understanding of basic biology and can be enhanced only through the ongoing novel discoveries. More importantly, the extent of "uncertainty" (inherent with the default assumptions associated with the NOAEL or benchmark approach) reducible by BBDR modeling requires further scrutiny and comparison.

Abnormalities, Drug-Induced↗
PubMed2000

Oral feeding in premature infants: advantage of a self-paced milk flow.

An earlier study demonstrated that oral feeding of premature infants (<30 wk gestation) was enhanced when milk was delivered through a self-paced flow system. The aims of this study were to identify the principle(s) by which this occurred and to develop a practical method to implement the self-paced system in neonatal nurseries. Feeding performance, measured by overall transfer, duration of oral feedings, efficiency, and percentage of successful feedings, was assessed at three time periods, when infants were taking 1-2, 3-5, and 6-8 oral feedings/day. At each time period, infants were fed, sequentially and in a random order, with a self-paced system, a standard bottle, and a test bottle, the shape of which allowed the elimination of the internal hydrostatic pressure. In a second study, infants were similarly fed with the self-paced system and a vacuum-free bottle which eliminated both hydrostatic pressure and vacuum within the bottle. The duration of oral feedings, efficiency, and percentage of successful feedings were improved with the self-paced system as compared to the standard and test bottles. The results were similar in the comparison between the self-paced system and the vacuum-free bottle. Elimination of the vacuum build-up naturally occurring in bottles enhances the feeding performance of infants born <30 wk gestation as they are transitioned from tube to oral feeding. The vacuum-free bottle is a tool which caretakers can readily use in neonatal nurseries.

Equipment Design↗
PubMed2000

Feeding tolerance in premature infants fed fortified human milk.

BACKGROUND: To evaluate feeding tolerance in premature infants immediately after the addition of human milk fortifier (HMF) to their expressed human milk diet. METHODS: Data on milk intake, feeding tolerance, and related assessments and growth milestones from a prospective study of feeding strategies in premature infants were analyzed. The database was searched for the first day HMF was added to the feeding of infants receiving human milk exclusively. The following assessments were tabulated for the 5 days before and the 5 days after the addition of HMF: milk intake, the number of episodes of abdominal distension, gastric residual volume (GRV) more than 2 ml/kg and more than 50% of the volume fed in the prior 3 hours. bile-stained gastric residual, emesis or regurgitation, blood in the stool, the number of abdominal radiographs, the number of episodes of apnea and bradycardia, changes in findings in the clinical examination, and the number of hours feeding was withheld. The time to achieve full tube feeding, complete oral feeding, and hospital discharge were recorded. RESULTS: Seventy-six exclusively human milk-fed premature infants (birth weight, 1065+/-18 g; gestational age, 27+/-0.1 weeks; mean +/- SEM) who received HMF beginning 22+/-0.8 days of age were evaluated. There were significant increases in milk intake and in the number of episodes of GRV more than 2 ml/kg and emesis after the addition of HMF. There were no differences in the number of hours feeding was withheld or any other assessment after the addition of HMF. Infants with increases in GRV more than 2 ml/kg and/or emesis after the addition of HMF were not more likely to be delayed in the time to achieve full tube feeding, complete oral feeding, or hospital discharge than infants who did not experience these events. CONCLUSION: These data suggest that, when all feeding and related assessments and the time to achieve important growth milestones are considered, the addition of HMF does not adversely affect the outcome of the premature infant.

Enteral Nutrition↗
PubMed2000

A cardiac evoked response algorithm providing threshold tracking: a North American multicenter study. Clinical Investigators of the Microny-Regency Clinical Evaluation Study.

The purpose of this study was to evaluate a pacing system using the recognition of cardiac evoked response for the automatic adjustment of pacing output. Patients were prospectively followed after primary implantation of VVIR pacemakers using AutoCapture (St. Jude Medical CRMD). Sensing and pacing thresholds, polarization signal, evoked response, and AutoCapture performance were evaluated with serial visits and 24-hour Holter monitoring. Three hundred ninety-eight patients (mean age 71 +/- 15 years) were followed for an average duration of 1 year (3 days-1.75 years) with the algorithm functional in > 90% of patients. Backup pacing in the event of exit block was confirmed in all patients. Pacing thresholds remained stable at 0.89 +/- 0.34 V with a pulse width of 0.31 ms (with chronic output autoset at 0.3 V above the actual threshold). Evoked response exhibited a small but statistically significant increase with time (8.92 mV at implant, 9.60 mV at 12 months), however, this finding did not result in any change in AutoCapture function during our follow-up period. The polarization signal remained stable with minimal variation (1.12 mV at implant, 1.18 at 12 months). No clinical adverse events were observed using the AutoCapture algorithm. In this initial experience with the AutoCapture algorithm the evoked response and polarization measurements remained adequate, allowing the system to function in the majority of patients with safe, low output pacing. High energy backup pacing provided an added safety feature over fixed output devices in cases of unexpected threshold rises. Longer follow-up is required for continued long-term validation of the algorithm.

Aged↗
PubMed2000

Biologically based risk assessment models for developmental toxicity.

It is obvious that the task of incorporating mechanistic information into dose-response assessment for developmental toxicity is, by and large, still at its conceptual stage. Our immature understanding of embryogenesis and teratogenesis forces us to make simplifying biological assumptions that may turn out to be erroneous; therefore, these mechanistically based models should be constructed so as to be easily modified as new information becomes available. The data-intensive (and costly) nature of these modeling efforts may also limit their practice to extraordinary situations where, for instance, large segments of the human population are exposed to low levels of a compound and the determination of a safe level of exposure is of utmost importance, or where compounds are of such immense economic or therapeutic value that their use would warrant a concerted effort to minimize the uncertainties inherent in the current methods of extrapolation. Nevertheless, this chapter has presented several attempts to translate the concept of BBDR into practice. When these applications become successful, these models should provide risk assessors with more reliable response indicators at low doses (where human exposures are realistic) and more accurate cross-strain/cross-species comparisons as well as extrapolations across exposure conditions. Although the BBDR models do not necessarily redefine the current practice of risk assessment using either the NOAEL or the benchmark approach, information derived from these efforts should provide a credible scientific basis for the estimates of RfD.

Animals↗
PubMed1999

Identification of a large region of secondary structure in the 3'-untranslated region of chicken elastin mRNA with implications for the regulation of mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal vascular development. Our laboratory has previously shown that changes in elastin mRNA stability contribute to this developmental decrease in elastin production. Here we identify a large region of stable secondary structure in the 3'-untranslated region (3'-UTR) of chicken elastin mRNA. Reverse transcriptase polymerase chain reaction or polymerase chain reaction amplification of the 3'-UTR consistently resulted in products with an approximately 328-bp deletion from the central region of the 3'-UTR, suggesting the presence of secondary structure. The presence of this structure was confirmed by probing the 3'-UTR with RNases with selectivity for single- or double-stranded RNA. Gel migration shift assays using cytosolic extracts from 2-day old chicken aorta demonstrate specific binding of a cytosolic protein to riboprobes containing the 3'-UTR of elastin but not to riboprobes either corresponding to other areas of the message or containing the 3'-UTR but lacking the region of secondary structure. Binding of cytosolic protein was particularly prominent in aortic extracts from 2-day old chickens, a time when elastin message is stable, as compared with 8- and 15-week old chickens, when the elastin message is relatively unstable, suggesting that this region of secondary structure may play a role in developmental regulation of stability of elastin mRNA.

Animals↗
PubMed1999

Serum theorem

Explore the source record for details and available documents.

Journal Article↗
PubMed1999

Feeding strategies for premature infants: randomized trial of gastrointestinal priming and tube-feeding method.

BACKGROUND: Data on enteral feeding management of premature infants are limited and often not the subject of randomized clinical trials. Several small studies suggest benefits from the early initiation of feeding, but do not assess the combined effects of time of initiation of feeding, tube-feeding method, and type of milk used. Either singly or in combination, these treatments may affect growth, bone mineralization, biochemical measures of nutritional status, and feeding tolerance, and, ultimately, the duration of hospitalization. METHODS: A total of 171 premature infants, stratified by gestational age (26 to 30 weeks) and diet (human milk or preterm formula) were assigned randomly among four treatment combinations in a balanced two-way design comparing the presence or absence of gastrointestinal (GI) priming for 10 days and continuous infusion versus intermittent bolus tube-feeding. RESULTS: The major outcome, time required for infants to attain full oral feeding, was similar among treatments. GI priming was not associated with any measured adverse effect and was associated with better calcium and phosphorus retention, higher serum calcium and alkaline phosphatase activity, and shorter intestinal transit times. The bolus tube-feeding method was associated with significantly less feeding intolerance and greater rate of weight gain than the continuous method. In addition, the greater the quantity of human milk fed, the lower the morbidity. CONCLUSIONS: Early GI priming with human milk, using the bolus tube-feeding method, may provide the best advantage for the premature infant.

Body Weight↗
PubMed1999

Feeding strategies for premature infants: beneficial outcomes of feeding fortified human milk versus preterm formula.

BACKGROUND: In a large-scale study of feeding strategies in premature infants (early vs later initiation of enteral feeding, continuous vs bolus tube-feeding, and human milk vs formula), the feeding of human milk had more effect on the outcomes measured than any other strategy studied. Therefore, this report describes the growth, nutritional status, feeding tolerance, and health of participating premature infants who were fed fortified human milk (FHM) in comparison with those who were fed exclusively preterm formula (PF). METHODS: Premature infants were assigned randomly in a balanced two-way design to early (gastrointestinal priming for 10 days) versus late initiation of feeding (total parenteral nutrition only) and continuous infusion versus intermittent bolus tube-feeding groups. The type of milk was determined by parental choice and infants to receive their mother's milk were randomized separately from those to receive formula. The duration of the study spanned the entire hospitalization of the infant. To evaluate human milk versus formula feeding, we compared outcomes of infants fed >50 mL. kg-1. day-1 of any human milk (averaged throughout the hospitalization) with those of infants fed exclusively PF. Growth, feeding tolerance, and health status were measured daily. Serum indices of nutritional status were measured serially, and 72-hour nutrient balance studies were conducted at 6 and 9 weeks postnatally. RESULTS: A total of 108 infants were fed either >50 mL. kg-1. day-1 human milk (FHM, n = 62) or exclusively PF (n = 46). Gestational age (28 +/- 1 weeks each), birth weight (1.07 +/- 0.17 vs 1.04 +/- 0.19 kg), birth length and head circumference, and distribution among feeding strategies were similar between groups. Infants fed FHM were discharged earlier (73 +/- 19 vs 88 +/- 47 days) despite significantly slower rates of weight gain (22 +/- 7 vs 26 +/- 6 g. kg-1. day-1), length increment (0.8 +/- 0.3 vs 1.0 +/- 0.3 cm. week-1), and increment in the sum of five skinfold measurements (0.86 +/- 0.40 vs 1.23 +/- 0.42 mm. week-1) than infants fed PF. The incidence of necrotizing enterocolitis and late-onset sepsis was less in the FHM group. Overall, there were no differences in any measure of feeding tolerance between groups. Milk intakes of infants fed FHM were significantly greater than those fed PF (180 +/- 13 vs 157 +/- 10 mL. kg-1. day-1). The intakes of nitrogen and copper were higher and magnesium and zinc were lower in group FHM versus PF. Fat and energy absorption were lower and phosphorus, zinc, and copper absorption were higher in group FHM versus PF. The postnatal retention (balance) surpassed the intrauterine accretion rate of nitrogen, phosphorus, magnesium, zinc, and copper in the FHM group, and of nitrogen, magnesium, and copper in the PF group. CONCLUSIONS: Although the study does not allow a comparison of FHM with unfortified human milk, the data suggest that the unique properties of human milk promote an improved host defense and gastrointestinal function compared with the feeding of formula. The benefits of improved health (less sepsis and necrotizing enterocolitis) associated with the feeding of FHM outweighed the slower rate of growth observed, suggesting that the feeding of FHM should be promoted actively in premature infants.

Animals↗
PubMed1999

The use of human milk and breastfeeding in premature infants.

Human milk is beneficial in the management of premature infants. The beneficial effects generally relate to improvements in host defenses, digestion, and absorption of nutrients, gastrointestinal function, neurodevelopment, and maternal psychological well-being. The use of fortified human milk generally provides the premature infant adequate growth, nutrient retention, and biochemical indices of nutritional status when fed at approximately 180 mL/kg/day compared with unfortified human milk. Human milk can only support the needs of the premature infant if adequate milk volumes are produced. Intensive efforts at lactation support are desirable. Therefore, neonatal centers should encourage the feeding of fortified human milk for premature infants along with skin-to-skin contact as a reasonable method to enhance milk production and promote success with early breastfeeding, while potentially facilitating the development of an enteromammary response.

Breast Feeding↗
PubMed1999

Perforated appendicitis is not a contraindication to laparoscopy.

Recent studies have reported an increased risk of intra-abdominal abscess formation following laparoscopic operation for perforated appendicitis. We undertook this study to compare laparoscopic versus open appendectomy in the treatment of perforated appendicitis. Records of all patients undergoing an appendectomy between January 1994 and June 1997 were reviewed, classifying appendicitis as acute, gangrenous, or perforated based on the intraoperative findings. Operative procedures were categorized as open, laparoscopic converted to open, or laparoscopic. The study group included 690 patients; four hundred fourteen (60%) were acute, 77 (11%) were gangrenous, and 199 (29%) were perforated. Although mean length of stay was shorter for all patients undergoing laparoscopic appendectomy, patients with perforated appendicitis had similar length of stay between treatment groups. Mean operative time for open appendectomy was significantly shorter than for converted or laparoscopic appendectomy regardless of diagnosis (P<0.01). Ten patients (1.4%) developed an intra-abdominal abscess: six after open appendectomy (1.7%), one after converted appendectomy (3.7%), and three after laparoscopic appendectomy (1%). There was no significant difference in rate of abscess formation in patients with perforated appendicitis undergoing open, converted, or laparoscopic appendectomy. We conclude that laparoscopic appendectomy for perforated appendicitis is not associated with an increased rate of intra-abdominal abscess formation.

Adolescent↗
PubMed1998

Sample preparation and high-performance liquid chromatographic analysis of deoxyribonucleoside triphosphates in individual rat embryos.

A rapid, robust, and sensitive method has been developed to measure concentrations of deoxyribonucleoside triphosphates in individual, day 14 rat embryos by modifying and optimizing existing methods for cellular extracts. Significant changes include: (i) oxidative degradation of ribonucleoside triphosphates using methylamine at lower pH (decreased from 6.5 to 4.0) to improve poor HPLC peak shape of early eluting nucleotides; (ii) glass fiber disc solid-phase extraction of the reaction mixture, which dramatically reduces impurities that interfere with nucleotide measurement, eliminates the necessity of column regeneration, and allows mobile phase recycling; and (iii) lower ionic strength (reduced from 0.4 to 0.26 or 0.12 M ammonium phosphate) and higher pH (increased from 3.25 to 5.55 or 6.98, respectively) mobile phase, conditions which are less destructive to the column's bonded phase and silica support, thereby contributing to longer column life. Enhancements include: (i) filtration of the sample prior to HPLC injection and addition of an in-line filter, guard column, and saturating precolumn of silica in the mobile phase flow, which aids substantially in extending column life and improves chromatographic stability, and (ii) inclusion of an internal standard to correct for mechanical losses. Limits of determination at a signal to noise ratio of 6:1 range from 5.5 to 12 pmol on-column or 0.41 to 0.87 pmol/mg of embryonic tissue depending on the specific nucleotide. Recoveries are quantitative for all nucleotides, and interassay variabilities are between 5 and 7% when quantified by peak height. The method has also been applied successfully to analysis of murine erythroleukemic cell cultures and this, when coupled with the embryo results, suggests its general utility.

Animals↗