PubMed Health⌕ Search

Biomedical subjects

Chih-Cheng Chen

Publications and source records attributed to Chih-Cheng Chen.

At least 19 recordsLinked to original sources
PubMed2006

The sensitivity of human mesenchymal stem cells to ionizing radiation.

PURPOSE: Recent studies have shown that mesenchymal stem cells (MSCs) obtained from bone marrow transplantation patients originate from the host. This clinical observation suggests that MSCs in their niches could be resistant to irradiation. However, the biologic responses of bone marrow MSCs to irradiation have rarely been described in the literature. METHODS AND MATERIALS: In this study, human bone marrow-derived, clonally expanded MSCs were used to investigate their sensitivity to irradiation in vitro, and the cellular mechanisms that may facilitate resistance to irradiation. The human lung cancer cell line A549 and the breast cancer cell line HCC1937 were used as controls for radiosensitivity; the former line has been shown to be radioresistant and the latter radiosensitive. We then examined their in vitro biologic changes and sensitivities to radiation therapy. RESULTS: Our results suggest that MSCs are characterized as resistant to irradiation. Several cellular mechanisms were demonstrated that may facilitate resistance to irradiation: ATM protein phosphorylation, activation of cell-cycle checkpoints, double-strand break repair by homologous recombination and nonhomologous end joining (NHEJ), and the antioxidant capacity for scavenging reactive oxygen species. CONCLUSIONS: As demonstrated, MSCs possess a better antioxidant reactive oxygen species-scavenging capacity and active double-strand break repair to facilitate their radioresistance. These findings provide a better understanding of radiation-induced biologic responses in MSCs and may lead to the development of better strategies for stem cell treatment and cancer therapy.

Ataxia Telangiectasia Mutated Proteins↗
PubMed2006

Retinopathy of prematurity in larger preterm infants.

Severe retinopathy of prematurity (ROP) usually occurs in preterm infants with birthweight<1500 g or gestational age<31 weeks. However, some exceptions occur in larger preterm infants. In southern Taiwan, six larger preterm infants with gestational age older than 31 weeks and birthweight>1500 g had stage III ROP in Chang Gung Memorial Hospital at Kaohsiung (Taiwan, Republic of China). All six infants were male and had received oxygen supplementation during hospitalization. Only one infant had received previous surgery and frequent packed red blood cell transfusions. Three infants received laser photocoagulation or cryotherapy, and all infants have good outcomes regardless of whether they received treatment. This report provides convincing evidence for expanding the screening criteria in our nursery and emphasizes the importance of assessing the risk of ROP for larger preterm infants.

Birth Weight↗
PubMed2006

Menhaden fish oil improves spatial memory in rat pups following recurrent pentylenetetrazole-induced seizures.

This study investigated the effects of two supplementary dietary oils (fish oil and corn oil) as parts of isocaloric/isoproteic diets on growth, brain fatty acid composition, and behavior in rat pups with recurrent seizures. Recurrent seizures were induced by injecting rat pups with pentylenetetrazole (PTZ) between P10 (10 days of age) and P14. Either menhaden fish oil (FO) or corn oil (CO) was given as supplemental dietary oil throughout the experiment from P3 to P40. We assessed the effects of the two supplemental dietary oils on spatial memory, histomorphology, and fatty acid composition of brain tissue at the end of the study on P40. Rats that received dietary FO performed significantly better in the Morris water maze, a test used to examine spatial performance in rats; the FO group had significantly shorter escape latencies (P=0.041) during the escape test. Compared with the CO group, the FO group stayed a longer time (P=0.015) and swam a longer distance (P=0.033) in the target quadrant in the spatial probe test. The FO group had significantly higher brain docosahexaenoic acid (P0.01) and significantly lower brain C20:3 n-6 and C20:4 n-6 (P<0.01 and P=0.031) levels compared with the CO group, but the two groups did not differ significantly with respect to neuronal cell loss in the histomorphology study. This study demonstrated that, compared with CO, FO is better in improving spatial memory in rats following recurrent PTZ-induced seizures.

Animals↗
PubMed2006

Air pollution and postneonatal mortality in a tropical city: Kaohsiung, Taiwan.

With growing evidence of the association between daily mortality and air pollution in adults, it is important to investigate whether infants are also susceptible to the adverse health effects of ambient air pollutants. The purpose of this study is to examine the relationship between air pollution and postneonatal mortality in Kaohsiung, Taiwan, a large industrial city with a tropical climate, during the period 1994-2000, using a case-crossover analysis. Case-crossover analysis provides an alternative to Poisson time-series regression for studying the short-term adverse health effects of air pollution. The air pollutants examined included particulate matter (PM(10)), sulfur dioxide (SO(2)), ozone (O(3)), nitrogen dioxide (NO(2)), and carbon monoxide (CO). The risk of postneonatal deaths was estimated to increase by 4.0% per 67 microg/m(3) (the interquartile range in daily ambient concentration of PM(10)) for PM(10), 1.8% per 17.84 ppb for NO(2), 5.1% per 0.31 ppm for CO, and 4.6% per 19.20 ppb for O(3). Although positive, none of these associations achieved statistical significance. The established link between air pollution levels and infant mortality may not be as strong in cities with tropical climates, although other factors such as differences in pollutant mix or the underlying health of the postneonates may explain the lack of a strong association in this study. Further studies of this type in cities with varying climates and cultures are needed.

Air Pollution↗
PubMed2006

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.

Alternative Splicing↗
PubMed2006

Construction and characterization of a novel fusion protein consisting of anti-CD3 antibody fused to recombinant interleukin-2.

T cells can be activated in vitro by monoclonal antibodies to CD3 (anti-CD3) to become non-MHC restricted killer cells (CD3-AK). Anti-CD3 activation upregulates the expression of the interleukin (IL)-2 receptors on T cells whose expansion is facilitated by IL-2. The therapeutic effect of in vivo administration of anti-CD3 and IL-2 has been investigated in many types of human cancers. To circumvent the toxicities posed by systemic administration of high-dose IL-2, there is interest in forming a strategy for targeting and concentrating IL-2 at the site where it is needed. This study investigates the feasibility of constructing a novel fusion protein consisting of IL-2 fused to the constant region of anti-CD3 antibody. Our results indicate that the specific IL-2 receptor-binding capability and bioactivity of the IL-2 portion as well as the CD3-binding and biological functions of anti-CD3 portion remain intact in this anti-CD3/IL-2 fusion protein. Thus, cytokines fused to anti-CD3 antibody by genetic engineering is feasible and may provide a new class of immunotherapeutics for cancer.

Animals↗
PubMed2005

Plasma antigen levels of thrombin-activatable fibrinolysis inhibitor did not differ in patients with or without disseminated intravascular coagulation.

Thrombin-activatable fibrinolysis inhibitor (TAFI) is a carboxypeptidase that downregulates fibrinolysis and might play some roles in the pathogenesis of disseminated intravascular coagulation (DIC). We prospectively examined the plasma TAFI antigen levels in patients highly suspected to be suffering from DIC. Patients were subdivided into overt DIC and non-DIC groups according to a DIC scoring system. The Sepsis-related Organ Failure Assessment (SOFA) scores were concurrently calculated on patients with sepsis. Overall, there were 23 non-DIC patients and 20 patients with overt DIC. Their baseline characteristics were similar, but patients with overt DIC had much more aberrant coagulation tests and higher lactate dehydrogenase levels. However, there was no significant difference between overt DIC and non-DIC patients regarding their TAFI antigen levels [median/interquartile range (IQR) 74.41/13.98 and 75.29/15.16, respectively, p=0.543]. On regression analysis, TAFI antigen levels were not correlated with either C-reactive protein levels or various coagulation test results. In patients with sepsis (n=31), TAFI levels among three risk groups stratified by low ( or=11) SOFA scores were not statistically disparate (median/IQR 65.24/15.14, 74.63/13.79, and 75.29/21.51, respectively, p=0.684), either. Our result indicated that plasma TAFI antigen levels did not vary significantly between patients with or without DIC. Further, they did not possess any correlation with the severity of organ injury in patients with sepsis. The role of TAFI antigen in the pathogenesis of DIC needs further elucidation by future studies.

Aged↗
PubMed2005

Predictive risk factors and prevalence of malignancy in patients with iron deficiency anemia in Taiwan.

Gastrointestinal (GI) tract malignancy is one of the important causes of chronic iron deficiency anemia (IDA). The present study was designed to find out the prevalence and the predictive risk factors of malignancy in the IDA patients. We performed a prospective study in 148 patients with chronic IDA. A series of examinations to explore the GI tract were performed either by radiology and/or endoscopy. A Tc-RBC GI bleeding study was also performed, and prevalence and risk factors of malignancy were calculated. Totally 148 patients were enrolled, with mean age 66.2 years; 88 were male. Eighteen patients (12.2%) were found to have malignant tumors. Ten (6.8%) had benign tumors, and 96 (64.9%) had other benign conditions. No lesions could be detected in 24 patients (16.2%). Clinical symptoms and presence of fecal occult blood could not predict malignancy or any GI lesions. Multivariate logistic regression analysis showed serum ferritin < or =10 microg/L, LDH >250 U/L, and aging as the risk factors of malignancy in the IDA patients (P = 0.003, 0.002, and 0.027; and OR = 7.614, 8.955, and 1.062, respectively). An IDA patient with both serum ferritin < or =10 microg/L and LDH >250 U/L ran a 74.33-times higher risk of malignancy than the patient without (95% CI: 7.115-776.479). Malignancy was an important cause of IDA. High LDH, low serum ferritin, and aging were the risk factors of malignancy in the IDA patients.

Adult↗
PubMed2005

Risk factors for hemodynamically-unrelated cystic periventricular leukomalacia in very low birth weight premature infants.

BACKGROUND AND PURPOSE: Periventricular leukomalacia (PVL) is one of the most important complications of prematurity, but its cause remains unclear. This study investigated the risk factors for hemodynamically-unrelated cystic PVL in very low birth weight (VLBW) premature infants. METHODS: VLBW premature infants admitted to the neonatal intensive care unit from 1998 through 2002 were included in this retrospective study. Infants who had congenital lethal anomalies or who died before a cranial scan could be done were excluded. All VLBW infants received serial cranial ultrasound examinations to screen for cystic PVL during hospitalization. Infants with cystic PVL were divided into those with or without a hemodynamic event of sufficient severity to potentially cause cystic PVL. The charts of all included infants were reviewed and relevant clinical parameters were analyzed. RESULTS: Cystic PVL occurred in 20 VLBW infants (6.9%) during the study period. Four of these infants (20%) had hemodynamic events before the development of cystic PVL and 16 (80%) had hemodynamically-unrelated cystic PVL. Univariate analysis showed that infants with hemodynamically-unrelated cystic PVL were more likely to have symptomatic patent ductus arteriosus (PDA) [p < 0.01] and bronchopulmonary dysplasia (BPD) [p < 0.01]. However, logistic regression indicated VLBW premature infants with BPD combined with symptomatic PDA (odds ratio, 8.92; 95% confidence interval, 2.55-31.20; p < 0.01) were at greatest risk for development of hemodynamically-unrelated cystic PVL. CONCLUSION: BPD and symptomatic PDA were more common in infants with hemodynamically-unrelated cystic PVL, although the reasons for these associations were unclear. Serial cranial scans are strongly suggested for VLBW premature infants with BPD and symptomatic PDA to screen for the development of cystic PVL.

Bronchopulmonary Dysplasia↗
PubMed2005

The effect of supplementation of docosahexaenoic acid and arachidonic acid on visual acuity and neurodevelopment in larger preterm infants.

BACKGROUND: Preterm infants may be born with deficits of both docosahexaenoic acid (DHA) and arachidonic acid (AA), but studies on supplementation of DHA and AA for preterm infants are limited. METHODS: Preterm infants with a gestational age between 30 and 37 weeks who met all the inclusion criteria were enrolled in this double blind, randomized, comparative study. Infants over 2000 g body weight, over 32 weeks of gestation and in full feeding status would enter into the active intervention period of 6 months. Sixteen infants received Neoangelac Plus with AA and DHA supplementation. Eleven infants received Neoangelac without AA and DHA supplementation. The babies had scheduled physical examinations and their cognitive development, visual acuity, and vital signs to be checked. Adverse events were also recorded. RESULTS: The mean Mental Development Index (MDI) scores for the supplementation and non-supplementation groups were 96.1 +/- 8.6 and 91.7 +/- 10.4 respectively at 6 months and 98.7 +/- 8.0 and 90.5 +/- 6.9 respectively at 1 year. The mean Physical Development Index (PDI) scores of these two groups were 102.2 +/- 10.5 and 95.4 +/- 13.2 respectively at 6 months and 98.0 +/- 5.8 and 86.7 +/- 11.1 respectively at 1 year. By repeated measures ANOVA, significant differences existed between groups for MDI and PDI (p = 0.020 and 0.008). However, there were no differences in visual acuity, physical examination variables or vital signs between these two groups. No obvious adverse effects were observed during the study period. CONCLUSION: These results showed possible benefits in the neurodevelopment of larger preterm infants given formula supplemented with DHA and AA.

Arachidonic Acid↗
PubMed2004

Periventricular echogenicity is related to delayed neurodevelopment of preterm infants.

Periventricular leukomalacia (PVL) is one of the most commonly seen neuropathologic lesions and is related to many neurodevelopmental handicaps in premature infants. Periventricular echogenicities (PVE) are considered to be at the milder end of the spectrum of PVL, and thus might affect the neurodevelopment of the preterm infants as well. In this retrospective cohort study medical records of 257 preterm infants who were discharged from our neonatal intensive care unit (NICU) during October 1996 to August 2000 were reviewed. A total of 114 records of preterm infants fulfilling our criteria were included in the survey. On the basis of the craniosonographic findings and birth history, the candidates were divided into three subgroups: group 1 (control) included infants with normal craniosonographic image during the neonatal period; group 2 included infants with PVEs for < 2 weeks during the neonatal period; group 3 included infants with PVEs> or = 2 weeks during the neonatal period. Neurodevelopmental assessment using the Bayley Scale of Infant Development II at 6, 12, and 18 months of corrected age of each group was compared. There were no significant differences among the three groups in gestational age, birth weight, and gender prevalence. Infants in group 3 had lower Mental Developmental Index and Psychomotor Developmental Index scores as compared with those in groups 1 and 2 at 6 ( p< 0.01), 12 ( p < 0.001), and 18 ( p < 0.01) months of corrected age, respectively. In conclusion, infants with PVEs that persisted for at least a 2-week period have significantly higher risk of delayed developmental outcomes as compared with infants with normal craniosonography or infants with PVEs that persisted for less than 2 weeks. It might be prudent to arrange therapeutic intervention for rehabilitation to these high-risk infants as early as possible to reduce the intensity of possible handicap in the future.

Cohort Studies↗
PubMed2004

Donor lymphocyte infusion induced acute hepatitis.

Hepatic graft-versus-host disease (GVHD) post allogeneic hematopoietic stem cell transplantation generally presents as cholestatic jaundice and increased serum alkaline phosphatase (ALK-P). Currently accepted standards for evaluating the clinical severity of hepatic GVHD are not based on serum aminotransferase levels but on the serum bilirubin levels. We describe a 25-year-old female who initially had no liver damage at all after an allogeneic peripheral blood stem cell transplantation (allo-PBSCT) from her HLA-indentical sister. Markedly elevated aminotransferases, without hyperbilirubinemia, however, developed 7 and 9 weeks after the first and second donor lymphocyte infusion (DLI), respectively. Liver biopsies performed in both events revealed lymphocytic infiltration of the portal tracts and pericentral necrosis of the lobuli. There was also a picture of periductal lymphocytic infiltration and vacuolization of the biliary epithelial cells, which was compatible with the diagnosis of GVHD of cholangiohepatitic type. These findings indicate that hepatic GVHD may present as acute hepatitis and should be included in the differential diagnosis for patients with increased aminotransferases after DLI.

Acute Disease↗
PubMed2003

Aggressive multiple myeloma with brain involvement in a young patient.

Multiple myeloma is generally a neoplastic plasma cell disorder of the old age. It seldom attacked young people or manifested intracranial plasmacytomas. Here we report a 28-year-old young patient of plasma cell dyscrasia who presented multiple plasmacytomas of bones while sparing bone marrow. Cerebral involvement with intratumorous hemorrhage complicated the clinical course. The unique clinical features are presented and literature is reviewed.

Adult↗
PubMed2003

Rapid detection of intron 22 inversions of the factor VIII gene in Chinese patients with severe hemophilia A.

BACKGROUND: Hemophilia A is caused by mutations in the gene for coagulation factor VIII. Recently, it has been reported that about half of the patients with severe hemophilia A have a large genomic inversion of the factor VIII gene. We tried to use a rapid method to detect this important mutation in the Chinese hemophiliacs. METHODS: Based on amplification of the leaky mRNA of factor VIII gene in peripheral blood lymphocytes, a reverse-transcription polymerase chain reaction (RT-PCR) method was applied to detect the inversion of intron 22 in the Chinese patients with severe hemophilia A. RESULTS: This mutation was detected in 7 of 20 (35%) severe hemophilia A patients from unrelated families. The mutation was not found in 3 patients of non-severe hemophilia A and 4 normal controls. Family history of bleeding tendency could not be traced in 3 of the 7 patients with intron 22 inversion. CONCLUSIONS: Intron 22 inversion of the factor VIII gene is the major genetic mutation for severe hemophilia A in Taiwan. There is a high probability of de novo mutation for this genetic change. The results were consistent with the concept that intron 22 inversion will always result in severe deficiency of factor VIII. Rapid detection of this common mutation can helpfully guide the direction of molecular study in genetic counselling.

Adolescent↗
PubMed2002

Variations of prothrombin time and international normalized ratio in patients treated with warfarin.

Prothrombin time is a standard screening test to monitor patients treated with oral anticoagulants. We hypothesize that INR measurements will not vary a lot within a given day in a given patient. The present study was thus conducted to compare the change of the international normalized ratio (INR) of prothrombin time (PT) within 1 day in patients treated with warfarin. Thirty such patients and nineteen healthy controls were enrolled into this study. PT was performed in four time points of a day in all subjects, two in the morning and two in the afternoon. The four INR values obtained were compared with each other to find little change in the series of time either in patients or in healthy controls. Neither were they affected by renal function, liver function, sex, age, hemoglobin, white cell count, platelet, treatment duration of warfarin, or alcoholic drinking. INR could be measured in any time of a day to have values equally valuable in clinical use.

Aged↗
PubMed2002

A role for ASIC3 in the modulation of high-intensity pain stimuli.

Acid-sensing ion channel 3 (ASIC3), a proton-gated ion channel of the degenerins/epithelial sodium channel (DEG/ENaC) receptor family is expressed predominantly in sensory neurons including nociceptive neurons responding to protons. To study the role of ASIC3 in pain signaling, we generated ASIC3 knockout mice. Mutant animals were healthy and responded normally to most sensory stimuli. However, in behavioral assays for pain responses, ASIC3 null mutant mice displayed a reduced latency to the onset of pain responses, or more pain-related behaviors, when stimuli of moderate to high intensity were used. This unexpected effect seemed independent of the modality of the stimulus and was observed in the acetic acid-induced writhing test (0.6 vs. 0.1-0.5%), in the hot-plate test (52.5 and 55 vs. 50 degrees C), and in tests for mechanically induced pain (tail-pinch vs. von Frey filaments). We postulate that ASIC3 is involved in modulating moderate- to high-intensity pain sensation.

Acid Sensing Ion Channels↗