Biomedical subjects

Christine J Weydert

Publications and source records attributed to Christine J Weydert.

9 recordsLinked to original sources

PubMed2006

Overexpression of manganese or copper-zinc superoxide dismutase inhibits breast cancer growth.

We have studied the effects of overexpression of superoxide dismutase (SOD), a tumor suppressor protein that dismutes superoxide radical to H2O2, on breast cancer cell growth in vitro and xenograft growth in vivo. No previous work has directly compared the growth-suppressive effects of manganese SOD (MnSOD) and copper-zinc SOD (CuZnSOD). We hypothesized that either adenoviral MnSOD (AdMnSOD) or adenoviral CuZnSOD (AdCuZnSOD) gene therapy would suppress the growth of human breast cancer cells. After determining the antioxidant profiles of three human breast cell lines, MCF 10A, MDA-MB231, and MCF-7, we measured the effects of MnSOD or CuZnSOD overexpression on cell growth and survival in vitro and in vivo. Results demonstrated that infection with AdMnSOD or AdCuZnSOD increased the activity of the respective enzyme in all three cell lines. In vitro, overexpression of MnSOD or CuZnSOD decreased not only cell growth but also clonogenic survival in a dose- and transgene-dependent manner. In vivo, treatment of tumors with AdMnSOD or AdCuZnSOD decreased xenograft growth compared to controls. The first direct comparison of MnSOD to CuZnSOD overexpression indicated that CuZnSOD and MnSOD were similarly effective at suppressing cancer cell growth.

Animals↗

PubMed2005

Manganese superoxide dismutase suppresses hypoxic induction of hypoxia-inducible factor-1alpha and vascular endothelial growth factor.

Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that governs cellular responses to reduced O2 availability by mediating crucial homeostatic processes. HIF-1 is composed of an HIF-1alpha subunit and an HIF-1beta subunit. HIF-1alpha is degraded following enzyme-dependent hydroxylation of prolines of HIF-1alpha in the presence of molecular oxygen, Fe2+, alpha-ketoglutarate, and ascorbate. These cofactors contribute to the redox environment of cells. The antioxidant enzyme manganese superoxide dismutase (MnSOD) also modulates the cellular redox environment. Here we show that MnSOD suppressed hypoxic accumulation of HIF-1alpha protein in human breast carcinoma MCF-7 cells. This suppression was biphasic depending on MnSOD activity. At low levels of MnSOD activity, HIF-1alpha protein accumulated under hypoxic conditions. At moderate levels of MnSOD activity (two- to six-fold increase compared to parent cells), these accumulations were blocked. However, at higher levels of MnSOD activity (>6-fold increase), accumulation of HIF-1alpha protein was again observed. This biphasic modulation was observed under both 1 and 4% O2. Coexpression of mitochondrial hydrogen peroxide-removing proteins prevented the accumulation of HIF-1alpha protein in cells with high levels of MnSOD; this effect demonstrates that the restabilization of HIF-1alpha observed in high MnSOD overexpressors is probably due to hydrogen peroxide, most likely produced from MnSOD. Hypoxic induction of vascular endothelial growth factor (VEGF) protein was also suppressed by elevated MnSOD activity and its levels reflected HIF-1alpha protein levels. These observations demonstrated that HIF-1alpha accumulation and VEGF expression could be modulated by the antioxidant enzyme MnSOD.

Adenocarcinoma↗

PubMed2005

Delayed radioprotection by nuclear transcription factor kappaB -mediated induction of manganese superoxide dismutase in human microvascular endothelial cells after exposure to the free radical scavenger WR1065.

The free radical scavenger WR1065 (SH) is the active thiol form of the clinically approved cytoprotector amifostine. At doses of 40 microM and 4 mM it can activate the redox-sensitive nuclear transcription factor kappaB (NFkappaB) and elevate the expression of the antioxidant gene manganese superoxide dismutase (MnSOD) in human microvascular endothelial cells (HMEC). MnSOD contains binding motifs for a number of transcription factors other than NFkappaB and codes for a potent antioxidant enzyme localized in the mitochondria that is known to confer enhanced radiation resistance to cells. The purpose of this study was to determine the effect of WR1065 exposure on the various transcription factors known to affect MnSOD expression along with the subsequent kinetics of intracellular elevation of MnSOD protein levels and associated change in sensitivity to ionizing radiation in HMEC. Cells were grown to confluence and exposed to WR1065 for 30 min. Affects on the transcription factors AP1, AP2, CREB, NFkappaB, and Sp1 were monitored as a function of time ranging from 30 min to 4 h after drug exposure using a gel-shift assay. Only NFkappaB exhibited a marked activation and that occurred 30 min following the cessation of drug exposure. MnSOD protein levels, as determined by Western blot analysis, increased up to 16-fold over background control levels by 16 h following drug treatment, and remained at 10-fold or higher levels for an additional 32 h. MnSOD activity was evaluated using a gel-based assay and was found to be active throughout this time period. HMEC were irradiated with X-rays either in the presence of 40 microM or 4 mM WR1065 or 24 h after its removal when MnSOD levels were most elevated. No protection was observed for cells irradiated in the presence of 40 microM WR1065. In contrast, a 4 mM dose of WR1065 afforded an increase in cell survival by a factor of 2. A "delayed radioprotective" effect was, however, observed when cells were irradiated 24 h later, regardless of the concentration of WR1065 used. This effect is characterized as an increase in survival at the 2 Gy dose point, i.e., a 40% increase in survival, and an increase in the initial slope of the survival curve by a factor of 2. The anti-inflammatory sesquiterpene lactone, Helenalin, is an effective inhibitor of NFkappaB activation. HMEC were exposed to Helenalin for 2 h at a nontoxic concentration of 5 microM prior to exposure to WR1065. This treatment not only inhibited activation of NFkappaB by WR1065, but also inhibited the subsequent elevation of MnSOD and the delayed radioprotective effect. A persistent marked elevation of MnSOD in cells following their exposure to a thiol-containing reducing agent such as WR1065 can result in an elevated resistance to the cytotoxic effects of ionizing radiation and represents a novel radioprotection paradigm.

Blotting, Western↗

PubMed2005

MnSOD inhibits proline oxidase-induced apoptosis in colorectal cancer cells.

Proline oxidase (POX), localized on inner mitochondrial membranes, is encoded by a p53-induced gene and metabolically participates in p53-induced apoptosis. Previously, we showed that POX catalyzed the generation of reactive oxygen species (ROS). We and others have demonstrated that overexpression of POX, independent of p53, causes apoptotic cell death in a variety of cancer cells. But a necessary role for ROS remains uncertain. Therefore, we asked whether superoxide dismutases (SOD) and catalase (CAT), important antioxidant enzymes, might interfere with the POX-dependent induction of apoptosis. In this study, we used DLD-1 colorectal cancer cells stably transfected with the POX gene under the control of a tetracycline-inducible promoter. When doxycycline was removed from the culture medium and the expression of POX was induced, apoptotic cell death was initiated. To examine the importance of the ROS-dependent component of the pathway, we infected DLD-1 POX cells with recombinant adenoviruses containing MnSOD, CuZnSOD, CAT or varying combinations of these adenoviruses followed by induced expression of POX. The expression of MnSOD inhibited POX-induced apoptosis, but others did not. Mechanistically, mitochondria-localized MnSOD dramatically reduced the release of cytochrome c to cytosol by POX. Compared with control cells, MnSOD-expressing DLD-1 POX cells generated a higher concentration of H2O2 owing to dismutation of superoxide radicals, which was elevated by POX. Thus, these data further suggest that the generation of superoxide radicals plays a crucial role in POX-induced apoptosis and the process is partially blocked by MnSOD.

Acetylcysteine↗

PubMed2004

Endogenous production and exogenous exposure to nitric oxide augment doxorubicin cytotoxicity for breast cancer cells but not cardiac myoblasts.

We studied the effect of nitric oxide (*NO) on the anticancer activity of doxorubicin. When MCF-7 human breast cancer cells were exposed to an aqueous solution of *NO delivered as a bolus 30 min prior to doxorubicin, the cytotoxic effect as measured in a clonogenic assay was increased (doxorubicin alone, 40% survival, doxorubicin plus *NO, 5% survival). The *NO donor diethylamine nitric oxide, but not inactivated donor, also yielded an increase in doxorubicin cytotoxicity. The sequence was important since the simultaneous application of *NO with doxorubicin yielded only a small augmentation of effect, and the exposure of the cells to doxorubicin prior to the *NO obliterated the augmentation. Prior depletion of glutathione by incubation of the cells for 24h with D,L-buthionine-S,R-sulfoximine (BSO) further increased the cytotoxicity so that BSO plus *NO plus doxorubicin killed all of the clones. MCF-7 cells transduced with inducible nitric oxide synthase gene (iNOS) through an adenoviral vector overexpressed iNOS and produced increased amounts of nitrite, an indicator of increased *NO production. These iNOS transduced cells were more susceptible to doxorubicin than vector control or wild-type cells. Cell cycle progression of iNOS transduced cells was not different from controls. Likewise, iNOS transduction resulted in no change in cellular glutathione levels. For comparison, we examined the effect of iNOS transduction on the sensitivity of MCF-7 to edelfosine, a membrane-localizing anticancer drug without direct DNA interaction. Insertion of the iNOS had no effect on killing of the MCF-7 cells by this ether lipid class drug. We also tested the effect of iNOS transduction on doxorubicin sensitivity of H9c2 rat heart-derived myoblasts. We found no augmentation of cytotoxicity by *NO, and this observation offers potential therapeutic tumor selectivity by using *NO with doxorubicin. Therefore, we conclude that *NO produced intracellularly by iNOS overexpression or delivered as a bolus sensitizes human breast cancer cells in culture to doxorubicin, but not to a cardiac cell line or to edelfosine. This augmentation is not due to a modulation of cell cycle distribution or measurable cellular glutathione resulting from the transduction.

Adenoviridae↗

PubMed2004

Redox regulation of pancreatic cancer cell growth: role of glutathione peroxidase in the suppression of the malignant phenotype.

Pancreatic cancer has low levels of antioxidant enzymes including manganese superoxide dismutase (MnSOD), which converts superoxide radical (O(2)(*-)) into hydrogen peroxide (H(2)O(2)), and glutathione peroxidase (GPx), which converts H(2)O(2) into water. Recent studies have demonstrated that overexpression of MnSOD has a tumor-suppressive effect in pancreatic cancer. However, GPx overexpression has been shown to reverse the tumor cell growth inhibition caused by MnSOD overexpression in other types of cancer. Our aims were to determine if overexpression of GPx alters in vitro pancreatic cancer cell behavior and if delivering the GPx gene directly to tumor xenografts alters growth and survival. In vitro, AdGPx slowed tumor growth by 39% and AdMnSOD slowed tumor growth by 35%. AdGPx also decreased plating efficiency and growth in soft agar. The combination of AdGPx and AdMnSOD had the greatest effect on tumor cell growth suppression with a 71% reduction in cell growth compared to controls. In vivo, either AdGPx or AdMnSOD alone slowed tumor growth by 51% and 54%, respectively, while the combination of AdGPx and AdMnSOD potentiated tumor growth suppression by 81% of controls and increased animal survival. GPx may be a tumor suppressor gene in pancreatic cancer. Delivery of the GPx gene alone or in combination with the MnSOD gene may prove beneficial for treatment of pancreatic cancer.

Adenoviridae↗

PubMed2003

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

Base Sequence↗

PubMed2002

Deficiency of glutathione peroxidase-1 sensitizes hyperhomocysteinemic mice to endothelial dysfunction.

OBJECTIVE: We tested the hypothesis that deficiency of cellular glutathione peroxidase (GPx-1) enhances susceptibility to endothelial dysfunction in mice with moderate hyperhomocysteinemia. METHODS AND RESULTS: Mice that were wild type (Gpx1+/+), heterozygous (Gpx1+/-), or homozygous (Gpx1-/-) for the mutated Gpx1 allele were fed a control diet or a high-methionine diet for 17 weeks. Plasma total homocysteine was elevated in mice on the high-methionine diet compared with mice on the control diet (23+/-3 versus 6+/-0.3 micromol/L, respectively; P<0.001) and was not influenced by Gpx1 genotype. In mice fed the control diet, maximal relaxation of the aorta in response to the endothelium-dependent dilator acetylcholine (10(-5) mol/L) was similar in Gpx1+/+, Gpx1+/-, and Gpx1-/- mice, but relaxation to lower concentrations of acetylcholine was selectively impaired in Gpx1-/- mice (P<0.05 versus Gpx1+/+ mice). In mice fed the high-methionine diet, relaxation to low and high concentrations of acetylcholine was impaired in Gpx1-/- mice (maximal relaxation 73+/-6% in Gpx1-/- mice versus 90+/-2% in Gpx1+/+ mice, P<0.05). No differences in vasorelaxation to nitroprusside or papaverine were observed between Gpx1+/+ and Gpx1-/- mice fed either diet. Dihydroethidium fluorescence, a marker of superoxide, was elevated in Gpx1-/- mice fed the high-methionine diet (P<0.05 versus Gpx1+/+ mice fed the control diet). CONCLUSIONS: These findings demonstrate that deficiency of GPx-1 exacerbates endothelial dysfunction in hyperhomocysteinemic mice and provide support for the hypothesis that hyperhomocysteinemia contributes to endothelial dysfunction through a peroxide-dependent oxidative mechanism.

Animals↗

PubMed2002

Delayed cytoprotection after enhancement of Sod2 (MnSOD) gene expression in SA-NH mouse sarcoma cells exposed to WR-1065, the active metabolite of amifostine.

SA-NH mouse sarcoma cells were grown to confluence and then exposed to either 40 microM or 4 mM of WR-1065, i.e. the active thiol form of amifostine, for 30 min and then washed. Total RNA and protein were isolated at various times up to 24 h after exposure. Both concentrations of WR-1065 were equally effective in affecting Sod2 (also known as MnSOD) gene expression and protein levels. Northern blot analysis using a mouse cDNA probe revealed three Sod2 transcripts of 1, 4 and 6 kb. Expression of both the 4- and 6-kb transcripts increased by 20 and 60%, respectively, and remained elevated over a period of 4 to 20 h. Sod2 protein levels, as determined by Western blot analysis, increased 15-fold over background control levels over the same interval. Sod2 protein was evaluated using activity gels and was found to be active. SA-NH cells were irradiated with X rays either in the presence of 40 microM or 4 mM WR-1065 or 24 h later after its removal, when Sod2 protein levels were most elevated. No protection was observed for cells irradiated in the presence of 40 microM WR-1065. In contrast, survival after a dose of 2 Gy was elevated 1.27-, 1.14- and 1.20-fold in SA-NH cells irradiated in the presence of 4 mM WR-1065 or 24 h after exposure of the cells to 40 microM and 4 mM WR-1065, respectively. The increased survival levels observed 24 h after exposure to WR-1065 represents a delayed radioprotective effect of WR-1065 and corresponds to the time at which Sod2 protein levels are most elevated. These data demonstrate a novel mechanism for radioprotection by WR-1065 and suggest a new potential concern regarding the issue of tumor protection.

Animals↗