PubMed Health⌕ Search

Biomedical subjects

D Breviario

Publications and source records attributed to D Breviario.

16 recordsLinked to original sources
PubMed1995

Molecular cloning of two novel rice cDNA sequences encoding putative calcium-dependent protein kinases.

We have isolated, from a cDNA library constructed from rice coleoptiles, two sequences, OSCPK2 and OSCPK11, that encode for putative calcium-dependent protein kinase (CDPK) proteins. OSCPK2 and OSCPK11 cDNAs are related to SPK, another gene encoding a rice CDPK that is specifically expressed in developing seeds [20]. OSCPK2 and OSCPK11-predicted protein sequences are 533 and 542 amino acids (aa) long with a corresponding molecular mass of 59436 and 61079 Da respectively. Within their polypeptide chain, they all contain those conserved features that define a plant CDPK; kinase catalytic sequences are linked to a calmodulin-like regulatory domain through a junction region. The calmodulin-like regulatory domain of the predicted OSCPK2 protein contains 4 EF-hand calcium-binding sites while OSCPK11 has conserved just one canonical EF-hand motif. In addition, OSCPK2- and OSCPK11-predicted proteins contain, at their N-terminal region preceding the catalytic domain, a stretch of 80 or 74 residues highly rich in hydrophilic amino acids. Comparison of the NH2-terminal sequence of all three rice CDPKs so far identified (OSCPK2, OSCPK11 and SPK) indicates the presence of a conserved MGxxC(S/Q)xxT motif that may define a consensus signal for N-myristoylation. OSCPK2 and OSCPK11 proteins are both encoded by a single-copy gene and their polyadenylated transcripts are 2.4 and 3.5 kb long respectively. OSCPK2 and OSCPK11 mRNAs are equally abundant in rice roots and coleoptiles. A 12 h white light treatment of the coleoptiles reduces the amount of OSCPK2 mRNA with only a slight effect on the level of OSCPK11 transcript. With anoxic treatments, OSCPK2 mRNA level declined significantly and promptly while the amount of OSCPK11 transcript remained constant.

Amino Acid Sequence↗
PubMed1993

Rice membranes contain a calcium-dependent protein kinase activity with biochemical features of animal protein kinase C.

The presence of calcium-dependent protein kinase activities in rice was investigated. Membrane preparations could phosphorylate the MARCKS peptide, a highly specific substrate for animal protein kinase C (PKC). Phosphorylation, strictly dependent on calcium, was specifically antagonized by a peptide whose amino acid sequence corresponds to the inhibitory, pseudosubstrate domain of mammalian PKC. Similar results have been obtained with rice soluble fractions. Addition of inhibitors of mammalian PKC (staurosporine and calphostin C) also inhibited phosphorylation of specific peptide substrates. Western blot analysis with anti-PKC antibodies identified three major bands (90, 87 and 54 kD) in rice membrane-associated proteins.

Blotting, Western↗
PubMed1993

Evolutionary conservation of genomic sequences related to the GGP1 gene encoding a yeast GPI-anchored glycoprotein.

The GGP1 gene encodes the only GPI-anchored glycoprotein (gp115) that has been purified to-date in the budding yeast Saccharomyces cerevisiae. It is a single-copy gene whose deduced amino-acid sequence shares no significant homology to any other known protein. In this paper we report a Southern hybridization analysis of genomic DNA from different eukaryotic organisms to identify homologues of the GGP1 gene. We have analyzed DNA prepared from a unicellular green alga (Chlamydomonas eugametos), from two distantly related yeast species (Candida cylindracea and Schizosaccharomyces pombe), and from the common bean Phasoleus vulgaris. The moderate stringency of the experimental conditions and the high specificity of the probes used indicate that a single-copy of GGP1-related sequences exists in all these eukaryotic organisms. The chromosomal localization of the GGP1 gene in S. cerevisiae has also been determined.

Animals↗
PubMed1991

Cloning and transcriptional analysis of the ADE6 gene of Saccharomyces cerevisiae.

The Saccharomyces cerevisiae gene, ADE6, encoding 5'-phosphoribosylformyl glycinamidine synthetase (EC 6.3.5.3) has been cloned by complementation of an ade6 auxotroph. Transformation of ade6 mutants with ADE6-carrying centromeric plasmids restored normal, adenine-independent growth behavior in the recipients. Strains containing a disrupted ade6 allele were constructed and behaved as stable adenine auxotrophs. Southern transfer and genetic analyses of strains carrying a disrupted ade6 allele demonstrated that the cloned gene was ADE6 and not a suppressor. The cloned ADE6 DNA was mapped on the RAD2-proximal fragment of chromosome VII by hybridization on yeast chromosomes separated by pulsed-field gel electrophoresis. Northern-blot hybridization experiments show that the ADE6 region produces two different mRNA species of approx. 5 and 2 kb. Disappearance of the larger, but not the smaller, transcript is associated with ade6 mutations. A threefold repression in the amount of the 5-kb ADE6 mRNA is observed when growth medium is supplemented with exogenous adenine.

Adenine↗
PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗
PubMed1988

Accumulation of processing intermediates of the RAS2 protein in strain 112 of Saccharomyces cerevisiae.

Strain 112 (RAS1 RAS2) contains a naturally occurring mutation which significantly retards processing of the RAS2 gene product. This mutation, resulting in the accumulation of precursor forms of RAS2 protein, has been assigned by genetic analysis to a single chromosomal locus distinct from the RAS2 locus. In addition to the known precursor molecule of 41000 daltons (p41), 112 cells accumulate within the soluble fraction an intermediate form of RAS2 (p40-1), which migrates, in SDS-polyacrylamide gel, between p41 and the fully processed, membrane-bound 40,000 daltons (p40) product. We propose for RAS2 protein processing the following sequence of events: p41 greater than p40-1 greater than p40 where p40-1 represents a RAS2 intermediate required for the targeting of the protein to the plasma membrane.

Electrophoresis, Polyacrylamide Gel↗
PubMed1988

Multiple regulatory mechanisms control the expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae.

Expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae has been examined at the transcriptional and translational levels. When dextrose is the carbon source, the steady-state amount of RAS1 mRNA and the rate of RAS1 protein synthesis are reduced in parallel as cells approach the mid-exponential phase of growth. RAS1 mRNA levels and protein synthesis are very low at all stages of growth when ethanol rather than dextrose is provided as the sole carbon source. The rate of RAS2 protein synthesis is regulated differently. In cells cultured on dextrose, it is lowest in the early exponential phase, increases approximately 10-fold and remains nearly constant as cells approach stationary phase. By contrast, RAS2 mRNA is found at uniformly high levels at all phases of exponential growth, suggesting that the translational efficiency of RAS2 mRNA is repressed during the early exponential phase. This repression is not observed when ethanol is the sole carbon source. Nutrient starvation, resulting in G1 arrest and sporulation in diploids, leads to greatly decreased amounts of RAS2 mRNA, accomplished in part by selective repression of RAS2 transcripts with particular 5' ends. However, this reduction in RAS2 mRNA levels has little effect on the rate of RAS2 protein synthesis, suggesting that the translational efficiency of RAS2 mRNA is stimulated by nutrient starvation. The combination of transcriptional and translational controls which regulate yeast RAS gene expression seems to ensure that one or the other RAS proteins will be produced over a wide range of physiological states.

Cell Cycle↗
PubMed1986

Carbon source regulation of RAS1 expression in Saccharomyces cerevisiae and the phenotypes of ras2- cells.

Transcriptional analysis of the yeast RAS genes in different culture conditions suggests that the inability of ras2 mutants to grow in nonfermentable carbon sources results from the regulation of RAS1 mRNA expression. The amount of RAS1 mRNA is significantly repressed in cultures grown on the nonfermentable carbon sources ethanol and acetate. As a result, low RAS function should be expressed under these conditions in a ras2 mutant. This can explain the inability of ras2- cells to grow on nonfermentable carbon sources. This interpretation is supported by the finding that an extragenic suppressor of ras2- (sra6-15), which restores growth on ethanol or acetate, also leads to an increase in the amount of RAS1 mRNA under these conditions. The sra6-15 mutation does not alter the level of RAS1 mRNA in cells grown on glucose. The pattern of transcriptional regulation described for the RAS1 gene is not shared by RAS2, indicating differential control of the functionally homologous yeast RAS genes at the level of gene expression.

Carbon↗
PubMed1984

Replication pattern of human repeated DNA sequences.

Either aphidicolin- or thymidine-synchronized human HL-60 cells were used to study the replication pattern of a family of human repetitive DNA sequences, the Eco RI 340 bp family (alpha RI-DNA), and of the ladders of fragments generated in total human DNA after digestion with XbaI and HaeIII (alpha satellite sequences). DNAs replicated in early, middle-early, middle-late and late S periods were labelled with BUdR or with [3H]thymidine. The efficiency of the cell synchronization procedure was confirmed by the transition from a high-GC to a high-AT average base composition of the DNA synthesized going from early to late S periods. By hybridizing EcoRI 340 bp repetitive fragments to BUdR-DNAs it was found that this family of sequences is replicated throughout the entire S period. Comparing fluorograph densitometric scans of [3H]DNAs to the scans of ethidium bromide patterns of total HL-60 DNA digested with XbaI and HaeIII, it was observed that DNA synthesized in different S periods is characterized by approximately the same ladder of fragments, while the intensity of each band may vary through the S phase; in particular, the XbaI 2.4 kb fragment becomes undetectable in late S.

Base Sequence↗
PubMed1984

Phorbol ester-induced changes in human leukemic pre-B lines.

The genomic analysis of four non-T-leukemic lines NALM-1, KM-3, NALL-1, and NALM-16 shows a rearranged configuration of the immunoglobulin mu chain genes, indicating that they represent early B stages of differentiation. The differentiative potential of these pre-B cell lines was tested using the phorbol ester tumor promoter 12-O-tetradecanoyl phorbol-13-acetate (TPA). Phenotypic changes in the immunological marker profile (induction of BA-1 and BA-2 antigens) are observed, presumably reflecting events occurring in precursor B cells. However, no maturation to immunoglobulin mu chain production could be obtained. The limited maturation can be explained on the basis of possible aberrant mu chain gene rearrangements, or other mechanisms of a regulatory nature, preventing the transcription and/or the translation of rearranged mu chain genes.

Antigens, Neoplasm↗
PubMed1983

Acquisition of deoxyguanosine resistance by TPA-induced T lymphoid lines.

The human leukemic T cell line 8402, which contains terminal deoxynucleotidyl transferase (TdT) and phenotypically resembles precursor thymocytes, when exposed to the phorbol ester 12-O-tetradecanoyl phorbol-13-acetate (TPA) undergoes in vitro T maturation. TdT disappears from virtually all the cells and a fraction of TdT- -cells express specific T surface markers, such as the T3 determinant. Like T lymphocytes from the thymus, 8402 cells are extremely sensitive to the cytotoxic effect of deoxyguanosine (dGuo). As a consequence of TPA treatment, resistance to dGuo is observed in 8402, as well as in two other TdT+ lymphoid T cell lines, Molt-4 and CEM-10. These results suggest the occurrence of changes in deoxynucleoside metabolism in TPA-treated cells related to the in vitro maturation process. Maturation of 8402 cells, once started, progresses in the presence of additional physiologic stimuli provided by conditioned medium from lymphocyte culture, because a portion of cells display the T8+/T4- phenotype characteristic of cytotoxic/suppressor T cells. This in vitro lymphoid system may thus be used to study the relationships of molecular differentiation between precursor thymocytes and cytotoxic/suppressor T cells.

Animals↗