PubMed Health⌕ Search

Biomedical subjects

D Henning

Publications and source records attributed to D Henning.

At least 37 records · Page 2Linked to original sources
PubMed1994

Apoptosis in human tumor cells following treatment with p120 antisense oligodeoxynucleotide ISIS 3466.

Previously, we reported that treatment of LOX cells in vitro with phosphorothioate oligonucleotide ISIS 3466 (antisense to the human nucleolar protein p120-FB2) produced a 70% cell kill and morphological changes including nucleolar unravelling, chromatin condensation and fragmentation, and a reduction in mitotic figures consistent with apoptosis. This report shows that HeLa cells treated with ISIS 3466 also developed apoptosis: nucleosomal ladders were found when the DNA from the treated HeLa cells was extracted and run on agarose gels. The morphological changes consistent with apoptosis were found more frequently in the floating cells than in the attached cells. The percentages of floating cells and attached cells were indicators of the toxicity of the different oligonucleotides studied. Of these, oligonucleotide ISIS 3466 produced the highest percent of floating cells (78.4%). Treatment of HeLa cells with other oligonucleotides produced fewer floating cells, and the characteristic nucleosomal ladder was not found following DNA extraction.

Apoptosis↗
PubMed1994

Identification of the nuclear and nucleolar localization signals of the protein p120. Interaction with translocation protein B23.

The human p120 nucleolar protein is a cell cycle-related protein that peaks during the S phase and has been shown to be associated with a beaded fibrillar structure. To study domains responsible for the nucleolar localization of protein p120, initially deletion mutants were made that defined sequences containing the localization signals; then, fusion genes that were composed of segments of the p120 molecule joined to the N-terminal end of the Escherichia coli beta-galactosidase were constructed. In the absence of the localization signals the beta-galactosidase remained in the cytoplasm. When the identified nuclear localization signal containing the amino acid sequence 99-110 (NAPRGKKRPAPG) was fused to the beta-galactosidase, the protein localized to the nucleus. When only the identified nucleolar localization signal containing the amino acid sequence 40-57 (SKRLSSRARKRAAKRRLG) was fused to the beta-galactosidase, the fusion protein remained in the cytoplasm. When both the nuclear and nucleolar localization signals were fused to the beta-galactosidase it localized predominantly to the nucleolus. Nucleolar protein B23, a putative "shuttle protein," bound to amino acid sequence 24-56 of protein p120. Deletion analysis showed that amino acids 187-215 of protein B23 bound to protein p120. The results suggest that protein B23 may be part of the mechanism of protein targeting to the nucleolus.

3T3 Cells↗
PubMed1994

Differences in mercury contamination and elimination during feather development in gull and tern broods.

Eggs, feathers (down, body feathers from side/shoulder and back) and some dead chicks (liver) from broods of three species, herring full (Larus argentatus), black-headed gull (Larus ridibundus), and common tern (Sterna hirundo) from the German North Sea coast were collected to study intersibling differences in mercury contamination and elimination into the growing feathers. The mercury contamination in eggs, feathers, and liver of the terns was about four times that of the gulls; black-headed gulls had lowest mercury concentrations. The body feathers grow when the chicks became older had lower mercury levels than down in the more contaminated species (11% lower in herring gulls, 49% in common terns), indicating the advancing decontamination of the body by the plumage development. The elimination of mercury was greater in chicks with higher mercury levels. Down of the first hatched herring gull and common tern chick contained more mercury than down of the siblings hatched later, because of its higher burden derived from the first laid egg.

Animals↗
PubMed1993

The effect of antisense p120 construct on p120 expression and cell proliferation in human breast cancer MCF-7 cells.

Malignant transformation of NIH3T3 cells was observed by transfection with the pSVX vector containing a sense human p120 cDNA construct (pSVX120). Subsequent transfection of these transformed cells with a dexamethasone inducible antisense p120 construct (pMSG021) markedly reduced the expression of human p120 and the growth rate of these transformed cells (Perklaky et al., Cancer Res., (1992) 52, 428-436). In the present study, a human breast cancer cell line (MCF-7) which expresses the p120 protein was transfected by electroporation with a pSVX plasmid-construct containing the antisense p120 cDNA (pSVX021). Clones containing the pSVX021 construct were selected and analyzed for expression of p120 mRNA, protein and growth characteristics. The expression of the p120 protein was inhibited by 44% in the antisense-transfected MCF-7pSVX021 cells; a 56% inhibition of cell-growth and a reduced colony formation in soft agarose were also observed. The growth of MCF-7 cells transfected with the p120 antisense construct was reduced by 93% in nude mice.

Animals↗
PubMed1993

Cellular pharmacology of p120 antisense oligodeoxynucleotide phosphorothioate ISIS 3466.

Previous studies demonstrated that an antisense phosphorothioate oligodeoxynucleotide, ISIS 3466, to the human nucleolar p120 protein, markedly inhibited the growth of human tumor cell lines in vitro and inhibited the growth of the human LOX tumor in vivo in an i.p./i.p. model, in the presence of DOTMA (Perlaky et al., Anti-Cancer Drug Design 8:3-14, 1993). In vitro, DOTMA enhanced the effect of the antisense oligodeoxynucleotide was associated with the LOX cells after 4 hr treatment than in the absence of DOTMA. A 100-fold higher concentration of the oligodeoxynucleotide was required to introduce the same amount of oligodeoxynucleotide into the cells in the absence of DOTMA than in the presence of DOTMA. Kinetic analysis showed that the cell-associated oligodeoxynucleotide accumulated rapidly and reached a plateau after 1 hr incubation. When these cells were placed in a complete medium without the oligodeoxynucleotide, there was a 50% decrease in the oligodeoxynucleotide after 21 hr. A 35% reduction of p120 mRNA and a 50% reduction of p120 protein was found after ISIS 3466 treatment. Further study is needed to explore the tumor-inhibitory mechanisms of the effects of antisense oligodeoxynucleotide ISIS 3466.

Base Sequence↗
PubMed1992

A region of antisense RNA from human p120 cDNA with high homology to mouse p120 cDNA inhibits NIH 3T3 proliferation.

The human nucleolar p120 protein is a proliferation-associated antigen which is expressed in G1 and peaks during the early S phase of the cell cycle. Overexpression of the human p120 protein caused the transformation of NIH 3T3 cells and expression of an antisense p120 construct inhibited the growth of NIH 3T3 cells (Perlaky et al., Cancer Res., 52:428-436, 1992). The middle region of the antisense p120 RNA was found to be almost as inhibitory as the full length antisense construct but the 5' and 3' antisense portions did not affect NIH 3T3 cell proliferation. After the mouse p120 complementary DNA was cloned and sequenced, comparison with the human p120 complementary DNA showed a striking conservation of 85% of the nucleotide sequence and 96% of the amino acid sequence. The two ends of the p120 molecule had less homology in their nucleotide and amino acid sequences. Based on this homology, the observed inhibitory effects of the middle portion of antisense human p120 RNA may be related to suppression of mouse p120 expression by RNA:RNA duplex formation. The high evolutionary conservation of the middle region suggests it has a critical role for the function of this protein.

3T3 Cells↗
PubMed1992

Cross-reactivity of monoclonal antibodies to bovine immunoglobulins with immunoglobulins of other species.

Monoclonal antibodies (Mabs) to bovine immunoglobulin heavy chain of the four major isotypes gamma 1, gamma 2, alpha, mu and the light chains (combined kappa and lambda) were produced and found to cross-react in enzyme-linked immunoassay (ELISA) with immunoglobulins of some other animal species despite the discrete specificity associated with an antibody derived from a single clone. This cross-reactivity, particularly amongst ruminants, could be utilized in serological testing for the diagnosis of disease in these species. For example, Mabs produced against bovine immunoglobulin light chain cross-react with bison immunoglobulin light chain and were used successfully in serological testing as the secondary detection antibody in an indirect ELISA for the diagnosis of Brucella abortus in bison herds in north-western Canada.

Animals↗
PubMed1992

Adverse behavioral effects in individuals with mental retardation and mood disorders treated with carbamazepine.

The incidence of carbamazepine-associated behavioral side effects in 65 individuals with mental retardation and additional seizure and/or psychiatric or behavioral disorders was evaluated. We identified 6 patients (9.2%) who experienced medication side effects, ranging from irritability to mania. Four of the 20 patients (20%) who received carbamazepine purely for treatment of a behavioral or psychiatric disorder experienced medication side effects, whereas none of the 21 patients treated for an isolated seizure disorder experienced similar effects. This difference was statistically significant, p less than .05. The incidence of behavioral side effects of medication was not associated with age, sex, or serum carbamazepine level. The chemical structure and mechanism of carbamazepine use in various disease processes were discussed.

Adolescent↗
PubMed1991

Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.

Base Sequence↗
PubMed1991

Dot immunoperoxidase assay using monoclonal antibody for detection of bluetongue virus antigens.

A rapid, simple dot immunoperoxidase assay (DIPA) is described for visual detection and identification of bluetongue virus (BTV) antigens in samples of infected cell culture fluid. The assay was performed using nitrocellulose (NC) paper and 'dipsticks'. Dots of samples were adsorbed to the NC surface and the remaining non-specific binding sites were blocked with skim milk solution. BTV was detected with either of two murine monoclonal antibodies (4H4, 5G12) to the major group specific antigens of BTV, and the complex was reacted with a peroxidase conjugated anti-mouse immunoglobulin G (heavy- and light-chain specific). Positive reactions were easily visualized as brown spots after enzyme degradation of substrate containing H2O2 and diaminobenzidine (DAB). The DIPA was specific in detecting BTV in samples of cell culture fluid from baby hamster kidney (BHK-21) cells infected with U.S.A. isolates of the five BTV serotypes (2, 10, 11, 13 and 17) known to exist in the U.S.A., and South African isolates of 17 BTV serotypes (1-12, 14-16, 18 and 20), but not with two North American isolates of epizootic hemorrhagic disease of deer virus (EHDV) representing serotypes 1 and 2. Attempts to detect BTV directly in infected sheep blood cells and chick embryo tissue suspensions by DIPA were unsuccessful. Of 55 cell culture fluid samples examined from BHK-21 or Vero cell monolayers inoculated with 55 clinical specimens, propagated initially in embryonating chicken egg (ECE) 11 proved positive and 44 were negative by DIPA. The results were in complete agreement with the conventional ECE and tissue culture isolation systems. The DIPA appears to have potential application, especially as a 'dipstick' kit, for rapid and inexpensive laboratory diagnosis of bluetongue virus infection.

Animals↗
PubMed1990

Insertion mutagenesis of the gene encoding the ferrichrome-iron receptor of Escherichia coli K-12.

The ferrichrome-iron receptor of Escherichia coli K-12 encoded by the fhuA gene is a multifunctional outer membrane receptor with an Mr of 78,000. It is required for the binding and uptake of ferrichrome and is the receptor for bacteriophages T5, T1, phi 80, and UC-1 as well as for colicin M. The fhuA gene was cloned into pBR322, and the recombinant plasmid pGC01 was mutagenized by the insertion of 6-base-pair TAB (two amino acid Barany) linkers into CfoI and HpaII restriction sites distributed throughout the coding region. A library of 18 TAB linker insertions in fhuA was generated; 8 of the mutations were at CfoI sites and 10 were at HpaII sites. All mutations inserted a hexamer that encoded a unique SacI site. A large deletion in fhuA was also isolated by TAB linker mutagenesis. Except for the deletion mutant, all of the linker insertion mutant FhuA proteins were found in the outer membrane in amounts similar to those found in the wild type. Five of the linker insertion mutants were susceptible to cleavage by endogenous proteolytic activity: a second FhuA-related band that migrated at approximately 72 kilodaltons could be detected on Coomassie blue-stained gels and on Western blots (immunoblots) by using a carboxy terminus-specific anti-peptide antibody. Receptor functions were measured with the mutated genes present in a single copy on the chromosome. Some of the receptors conferred wild-type phenotypes: they demonstrated growth promotion by ferrichrome and the same efficiency of plating as that of wild-type FhuA; killing by colicin M was also unaffected. Several mutants were altered in their sensitivities to the lethal agents. TAB linker insertions after amino acids 69 and 128 abolished all receptor functions. Phage T5 id not bind to these mutant FhuA proteins in detergent extracts. The deletion mutant was also defective in all FhuA functions. Sensitivity to the lethal agents of cellsl that expressed mutant FhuAs with insertions after amino acids 59 and 135 was reduced by several orders of magnitude. Insertion at other selected sites decreased some or all receptor functions only slightly. An insertion after amino acid 321 selectively eliminated ferrichrome growth promotion. Finally, a strain carrying a mutant fhuA gene on the chromosome in which the linker insertion occurred after amino acid 82 showed a tonB phenotype. These subtle perturbations that were introduced into the FhuA protein resulted in changes in its stability and in the binding and uptake of its cognate ligands.

Amino Acid Sequence↗
PubMed1990

Synthesis of the membrane fusion and hemagglutinin proteins of measles virus, using a novel baculovirus vector containing the beta-galactosidase gene.

An improved baculovirus expression vector was developed to expedite screening and facilitate oligonucleotide-directed mutagenesis. This vector contained twin promoters derived from the P10 and polyhedrin genes of Autographica californica nuclear polyhedrosis virus. The P10 promoter directed the synthesis of beta-galactosidase, whereas the polyhedrin promoter controlled the synthesis of foreign gene products. These two genes recombined with wild-type virus genome to yield recombinants which were polyhedrin negative, produced the foreign gene product, and formed blue plaques when beta-galactosidase indicator was present in the agarose overlay. An origin of replication derived from M13 or f1 bacteriophage was also included in the plasmid to permit the synthesis of single-stranded DNA. This template DNA was used to introduce or delete sequences through the process of site-specific mutagenesis. The measles virus virion possesses a membrane envelope which contains two glycoproteins: the hemagglutinin (H) and membrane fusion (F) proteins. The H polypeptide has receptor-binding and hemagglutinating activity, whereas the F protein mediates virus penetration of the host cell, formation of syncytia, and hemolysis of erythrocytes. Genes for these two glycoproteins were inserted into the NheI cloning site of the modified expression vector described above. The vector and purified wild-type viral DNA were introduced into Sf9 insect cells by calcium phosphate precipitation. A mixture of wild-type and recombinant virus was generated and used to infect Sf9 cells, which were subsequently overlaid with agarose. After 3 days, 0.1 to 1% of the plaques became blue in the presence of beta-galactosidase indicator. At least 70% of these blue viral colonies contained the foreign gene of interest as determined by dot blot analysis. Recombinant virus was separated from contaminating wild-type virus through several rounds of plaque purification. Insect cells were then infected with the purified recombinants, and synthesis of H and F proteins were verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by immunoblot detection and Coomassie blue staining. Glycosylation of the proteins appeared to be impaired somewhat, and the precursor to the F protein was not completely cleaved by the proteases present in insect host cells. On the other hand, both proteins appeared to be active in hemagglutination, hemolysis, and cell fusion assays. Levels of synthesis were in the order of 50 to 150 mg of protein per 10(8) cells.

Animals↗
PubMed1990

Genomic structure of the human proliferating cell nucleolar protein P120.

A gene for human proliferating cell nucleolar protein p120 has been isolated from a human genomic library using p120 cDNA as a probe. The gene spanned 12 kilobase pairs and was composed of 15 exons and 14 introns. Unusual splice junction sequences, (AT) and (AC), instead of (GT) and (AG), respectively, were located at the splice sites for intron F. The 5' flanking region was analyzed for putative cis-acting factor binding sites. The region contained a TATA-like sequence and the CCAAT box. CAT assays indicated that the region -2532 /+ 102 was necessary for transcription. Two specific areas at -1444/-1224 and -537/-278 were shown to be important for transcription. Two "GC" boxes and two "GC"-rich sequences were observed Other sites upstream of these sites were analyzed for homology to other gene control regions.

Base Sequence↗
PubMed1989

Secondary structure of 7SK and 7-2 small RNAs. Possible origin of some 7SK pseudogenes from cDNA formed through self-priming by 7SK RNA.

Pseudogenes having homology to small RNAs, like 7SL, 7SK, 6S, 4.5S, U1, U2, and U3 RNAs, are abundant and dispersed in the genomes of higher eukaryotes [reviewed in Weiner et al. (1986) Annu. Rev. Biochem. 55, 631-661]. To understand better the possible origin of these pseudogenes, we studied the abilities of cytoplasmic 7SL, 7SK, and nucleolar 7-2 RNAs to self-prime and result in the synthesis of cDNAs. When rat 7SK RNA was used as substrate, a 294-nucleotide-long cDNA was synthesized in vitro by reverse transcriptase, indicating that the 3' end of 7SK RNA can act in a self-priming manner to generate 7SK cDNA. When 7-2 RNA was used as a substrate, a cDNA of approximately 235 nucleotides was observed; 7SL RNA did not act as a self-primer. Earlier studies have shown that DNAs homologous to 7SK RNA are represented by a moderately reiterated family in the mammalian genomes and many of these sequences were found to be truncated 7SK pseudogenes [Murphy et al. (1984) J. Mol. Biol. 177, 575-590]. In this study, one 7SK clone from the rat genome was characterized by sequencing. This clone contained 243 base pairs homologous to the 5' end of 7SK RNA, and was flanked by direct repeats. These data suggest that, as previously proposed for some U3 pseudogenes [Bernstein et al. (1983) Cell 32, 461-472], one mechanism for the generation of truncated 7SK pseudogenes may be the integration of self-primed reverse transcripts of 7SK RNA at random genomic sites.

Animals↗
PubMed1989

mRNA levels for human nucleolar protein P120 in tumor and nontumor cells.

A monoclonal antibody to a human tumor nucleolar 120 kD protein was developed by Freeman et al. (Cancer Res. 48: 1244-1251, 1988). Its complementary DNA (cDNA) has been isolated and sequenced (Fonagy et al., submitted). To determine the relative messenger RNA (mRNA) level for protein p120, cellular mRNA was extracted, slot-blotted onto nitrocellulose filters, and hybridized to radioactive p120 cDNA fragments. Human tumor cells contained 15-60 times more p120 mRNA than human term placenta. The rat Novikoff hepatoma ascites cell mRNA hybridized to the p120 cDNA probes, but the p120 monoclonal antibody did not react with the Novikoff hepatoma proteins. Novikoff hepatoma mRNA contained 8 times as much p120 mRNA as normal rat liver. As a control, a cDNA was used for protein B23, an abundant nucleolar protein; there were 3.5, 29, and 14 times more B23 mRNA than p120 mRNA in normal rat liver, Novikoff hepatoma ascites cells, and HeLa cells, respectively. Whereas the increased levels of the mRNA and protein B23 reflect increased activity of the nucleolus for any increment of nucleolar function, the increased levels of p120 mRNA and the p120 protein reflect the activity of the G1 phase of the cell cycle. The elevated level of p120 mRNA in tumors may reflect the heightened G1 cascade in transformed cells.

Animals↗