Biomedical subjects

D L Beveridge

Publications and source records attributed to D L Beveridge.

At least 19 recordsLinked to original sources

PubMed2000

Molecular dynamics simulation accurately predicts the experimentally-observed distributions of the (C, N, O) protein atoms around water molecules and sodium ions.

A molecular dynamics simulation of the operator binding domain of the lambda repressor protein has been carried out. The protein was embedded in explicit waters, Na(+) and CL(-) ions. The Amber 4.1 computer package and the Cornell et al. Force field were used for energy-minimization and molecular dynamics simulation. We find that the atoms distributions in the environment of waters and Na(+) ions are in excellent agreement with those derived from the analysis of water molecules in crystal structures and ion-binding proteins. We also find that, on the whole, both distributions are similar to each other.

Carbon↗

PubMed2000

One nanosecond molecular dynamics simulation of the N-terminal domain of the lambda repressor protein.

We have carried out molecular dynamics simulation of the N-terminal domain of the lambda repressor protein in a surrounding environment including explicit waters and ions. We observe two apparent dynamics substates in the nanosecond protein simulation, the transition occurring around 500 ps. The existence of these two apparent substates results from a high flexibility of the arm in each monomer, a relative flexibility of both arms with respect to each other, and a relative displacement of the recognition helices from 30 to 40 A of interhelical distance. Many amino acid residues, including those involved in DNA recognition, undergo a simultaneous transition in their side-chain conformations, consistent with the relationship between side-chain conformation and secondary structural elements, as observed in protein crystal structures. This result suggests plausible conformational changes experienced by the protein upon DNA binding. On the whole, the non-consensus monomer appears to be more flexible than its consensus counterpart.

Amino Acid Sequence↗

PubMed2000

Nucleic acids: theory and computer simulation, Y2K.

Molecular dynamics simulations on DNA and RNA that include solvent are now being performed under realistic environmental conditions of water activity and salt. Improvements to force-fields and treatments of long-range interactions have significantly increased the reliability of simulations. New studies of sequence effects, axis bending, solvation and conformational transitions have appeared.

Chemical Phenomena↗

PubMed1999

Molecular dynamics studies of axis bending in d(G5-(GA4T4C)2-C5) and d(G5-(GT4A4C)2-C5): effects of sequence polarity on DNA curvature.

Gel retardation studies and other experiments indicate that DNA sequences containing the d(GA4T4C)n motif are curved, whereas those of identical composition but with a reverse sequence polarity, the d(GT4A4C)n motif, are straight. Hydroxyl radical cleavage experiments show that d(GA4T4C)n shows a unique signature, whereas d(GT4A4C)n behaves normally. To explain these results at a molecular level, molecular dynamics (MD) simulations were performed on the DNA duplexes d(G5-(GA4T4C)2-C5) and d(G5-(GT4A4C)2-C5) to 3.0 and 2.5 ns, respectively. The MD simulations are based on the Cornell force field implemented in the AMBER 4.1 modeling package and performed in a neutral solution of anionic DNA with K+, Cl- and Mg2+ at concentrations roughly comparable to a ligase buffer. Long range interactions were treated by the particle mesh Ewald method. Analysis of the results shows that the calculated dynamical structure of d(G5-(GA4T4C)2-C5) exhibits strong gross curvature, consistent with the observed behavior. The most significant locus of curvature in the MD structure is found at the central C15-G16 step, with an average roll angle of 12.8(+/-6.40)deg. The d(G5-(GT4A4C)2-C5) MD structure exhibited significantly less gross curvature. Analysis of results indicates that the reduction in gross curvature in the d(G5-(GT4A4C)2-C5) trajectory originates from the effect of the T10-A11 and T20-A21 steps, which showed average roll angles of 12.5(+/-5)deg. These three steps, T10-A11, C15-G16 and T20-A21, are half-helix turns away from one another, and their contributions to concerted bending cancel out. The A-tracts in the MD structure are essentially straight. The dynamical structure of d(G5-(GA4T4C)2-C5) exhibited minor groove deformation comprised of expansion at the 5' end of A-tracts and progressive narrowing towards the 3' end, consistent with and elaborating the interpretation of hydroxyl radical chemical probing results.

Base Sequence↗

PubMed1998

Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.

A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending.

Adenine↗

PubMed1998

Truly a team effort.

Jane was a healthy 16 year old girl who attended a high school dance and subsequently had a grand mal seizure--her first! She was taken home, developed a decreasing level of consciousness and was admitted to the local hospital, where it progressed to status epilepticus. We will describe the classifications of seizures including status epilepticus, which demands the highest level of clinical expertise and attention to preventative medicine, for a desirable outcome. During the eleven months of care a massive multi disciplinary team approach was instituted which extended across borders. Jane's story demonstrates a truly Neuroscience team effort from acute care to a rehabilitation center to home.

Adolescent↗

PubMed1997

A 5-nanosecond molecular dynamics trajectory for B-DNA: analysis of structure, motions, and solvation.

We report the results of four new molecular dynamics (MD) simulations on the DNA duplex of sequence d(CGCGAATTCGCG)2, including explicit consideration of solvent water, and a sufficient number of Na+ counterions to provide electroneutrality to the system. Our simulations are configured particularly to characterize the latest MD models of DNA, and to provide a basis for examining the sensitivity of MD results to the treatment of boundary conditions, electrostatics, initial placement of solvent, and run lengths. The trajectories employ the AMBER 4.1 force field. The simulations use particle mesh Ewald summation for boundary conditions, and range in length from 500 ps to 5.0 ns. Analysis of the results is carried out by means of time series for conformationalm, helicoidal parameters, newly developed indices of DNA axis bending, and groove widths. The results support a dynamically stable model of B-DNA for d(CGCGAATTCGCG)2 over the entire length of the trajectory. The MD results are compared with corresponding crystallographic and NMR studies on the d(CGCGAATTCGCG)2 duplex, and placed in the context of observed behavior of B-DNA by comparisons with the complete crystallographic data base of B-form structures. The calculated distributions of mobile solvent molecules, both water and counterions, are displayed. The calculated solvent structure of the primary solvation shell is compared with the location of ordered solvent positions in the corresponding crystal structure. The results indicate that ordered solvent positions in crystals are roughly twice as structured as bulk water. Detailed analysis of the solvent dynamics reveals evidence of the incorporation of ions in the primary solvation of the minor groove B-form DNA. The idea of localized complexation of otherwise mobile counterions in electronegative pockets in the grooves of DNA helices introduces an additional source of sequence-dependent effects on local conformational, helicoidal, and morphological structure, and may have important implications for understanding the functional energetics and specificity of the interactions of DNA and RNA with regulatory proteins, pharmaceutical agents, and other ligands.

Computer Simulation↗

PubMed1997

Conformational properties of the TATA-box binding sequence of DNA.

Nanosecond scale molecular dynamics simulations in water demonstrate that the DNA oligomer, GCGTATATAAAACGC, which contains a target site for the TATA-box binding protein (TBP), has an intrinsic preference to adopt an A-like conformation in the region of the TATA-box and undergoes bending related to that seen within in the TBP complex. This result is obtained from two independent simulations using different starting structures. In line with earlier suggestions of Guzikevich-Guerstein and Shakked, these simulations imply that an A-DNA conformation may be an important intermediate step in forming the strongly distorted DNA observed within the crystallographically determined complex with TBP. These results also support modeling studies by Lebrun et al. which suggest that the TBP binding mechanism can be broken down into a backbone transition to an A-like form coupled with a mechanical distortion which locally stretches and unwinds the DNA.

Binding Sites↗

PubMed1995

Analysis of local helix bending in crystal structures of DNA oligonucleotides and DNA-protein complexes.

Sequence-dependent bending of the helical axes in 112 oligonucleotide duplex crystal structures resident in the Nucleic Acid Database have been analyzed and compared with the use of bending dials, a computer graphics tool. Our analysis includes structures of both A and B forms of DNA and considers both uncomplexed forms of the double helix as well as those bound to drugs and proteins. The patterns in bending preferences in the crystal structures are analyzed by base pair steps, and emerging trends are noted. Analysis of the 66 B-form structures in the Nucleic Acid Database indicates that uniform trends within all pyrimidine-purine and purine-pyrimidine steps are not necessarily observed but are found particularly at CG and GC steps of dodecamers. The results support the idea that AA steps are relatively straight and that larger roll bends occur at or near the junctions of these A-tracts with their flanking sequences. The data on 16 available crystal structures of protein-DNA complexes indicate that the majority of the DNA bends induced via protein binding are sharp localized kinks. The analysis of the 30 available A-form DNA structures indicates that these structures are also bent and show a definitive preference for bending into the deep major groove over the shallow minor groove.

Base Sequence↗

PubMed1995

Structure determination and analysis of local bending in an A-tract DNA duplex: comparison of results from crystallography, nuclear magnetic resonance, and molecular dynamics simulation on d(CGCAAAAATGCG).

We have presented a detailed analysis for structure determinations for the DNA duplex d(CGCAAAAATGCG) obtained from X-ray crystallography, nuclear magnetic resonance, and molecular dynamics simulation. Each of the structures for the duplex deviates from the structure of the canonical form of B-DNA in a number of observable characteristics. Specifically, the three determinations all contain DNA axis deflections at the junctions of the A-tract with the flanking sequences. The analysis provided shows that the general characteristics of the structures obtained for d(CGCAAAAATGCG) from X-ray, NMR, and MD methods turn out to be quite similar. The extent to which this result can be generalized remains to be established by consideration of similar cross-comparisons on diverse oligonucleotide structures.

Base Sequence↗

PubMed1995

Back to basics.

As nurses, we are constantly bombarded by new technology, disguised as adjuncts to patient assessments. These are often time consuming, carrying us further away from our prime responsibility--our client. In this paper I hope to reacquaint ourselves with the most valuable assessment "tool" we possess and expand on how we can use it in our daily care. This tool is portable, has a long life span and has the capacity for increasing its capabilities. It is continuously upgraded, evaluated and calibrated. You've guessed by now--ourselves; our education, experience and problem solving abilities. To use this resource to its greatest potential requires a sound knowledge of neurological assessment and the ability to recognize abnormalities.

Humans↗

PubMed1994

Molecular dynamics studies of the human CD4 protein.

A dynamical model for an N-terminal fragment of the human CD4 protein has been determined by computer simulation. The protein has been studied both in vacuo and in solution. Data from both simulations agree moderately well with each other and with the crystal structure. All elements of secondary structure were retained during simulation. Point mutation and sequence replacement studies have shown that a loop in CD4, residues 40-52 is involved in binding with gp120, the human immunodeficiency virus surface glycoprotein. Our results show that the gp120-binding loop and a few regions which bind to monoclonal antibodies and class II MHC molecules are the most highly motile areas of the protein. These results are consistent with the suggestion that CD4 binds to target molecules by using induced-fit contacts.

Binding Sites↗

PubMed1994

Comparison of the 13C relaxation times and proton scalar couplings of BPTI with values predicted by molecular dynamics.

The experimental carbon-13 relaxation times of BPTI have been compared with the values predicted by molecular-dynamics simulations. Since the carbon-13 T1 values are sensitive monitors of the rates and amplitudes of the internal motions of the protein, this comparison was made to test the extent to which molecular dynamics provides an accurate depiction of the internal motions of proteins. The experimental and predicted amide-alpha scalar couplings were also compared, since this coupling is dependent on the conformation of the protein. These comparisons have shown that the molecular-dynamics simulation predicts results that are in good overall agreement with the experimental data.

Aprotinin↗

PubMed1994

Probing structure-function relationships in human immunodeficiency virus type 1 protease via molecular dynamics simulation.

This chapter has focused on the application of molecular dynamics computer simulations and related molecular modeling techniques to the study of HIV protease structure and structure-function relationships. The abundance of crystallographic data provides ample experimental quantities (average structures, temperature factors, and hydrogen bond topography) to validate the computational techniques employed. Furthermore, these studies provide insight into the structure and functional energetics of HIV-1 protease that would be difficult or impossible to study experimentally. This chapter covers studies that investigate correlated motion between and within subunits of the protease, mutants of the protease that disrupt the tertiary structure and dimer formation, and studies of HIV-1 protease-inhibitor complexes that rationalize both the protonation state of the active site and the observed binding strength of these complexes. These studies demonstrate that MD is capable of contributing to our understanding of structure-function relationships and may aid in the design of potential therapeutics.

Amino Acid Sequence↗

PubMed1993

Persistence analysis of the static and dynamical helix deformations of DNA oligonucleotides: application to the crystal structure and molecular dynamics simulation of d(CGCGAATTCGCG)2.

A theory and graphical presentation for the analysis of helix structure and deformations in oligonucleotides is presented. The parameters "persistence" and "flexibility" as defined in the configurational statistics of polymers of infinite length are reformulated at the oligonucleotide level in an extension of J. A. Schellman's method [(1974) Biopolymers, Vol. 17, pp. 217-226], and used as a basis for a systematic "Persistence Analysis" of the helix deformation properties for all possible subsequences in the structure. The basis for the analysis is a set of link vectors referenced to individual base pairs, and is limited to sequences exhibiting only perturbed rod-like behavior, i.e., below the threshold for supercoiling. The present application of the method is concerned with a physical model for the angular component of bending, so the link vectors are defined as the unit components of a global helix axis obtained by the procedure "Curves" of R. Lavery and H. Sklenar [(1988) J. Biomol. Struct. Dynam., Vol. 6, pp. 63-91; (1989) ibid., Vol. 6, pp. 655-667]. A discussion of the relationship between global bending and relative orientation of base pairs is provided. Our approach is illustrated by analysis of some model oligonucleotide structures with intrinsic kinks, the crystal structure of the dodecamer d(CGCGAATTCGCG)2, and the results of two molecular dynamics simulations on this dodecamer using two variations of the GROMOS force field. The results indicate that essentially all aspects of curvature in short oligonucleotides can be determined, such as the position and orientation of each bend, the sharpness or smoothness, and the location and linearity of subsequences. In the case of molecular dynamics simulations, where a Boltzmann ensemble of structures is analyzed, the spatial extent of the deformations (flexibility) is also considered.

Base Sequence↗

PubMed1993

Molecular dynamics simulations of poly(dA).poly(dT): comparisons between implicit and explicit solvent representations.

The program AMBER 3.0 has been used to generate molecular dynamics trajectories of a poly(dA).poly(dT) decamer. The simulations were performed using different methods to treat solvent effects. Results of a simulation including 18 counterions NH4+ and 4109 water molecules under (N, P, T) conditions were compared to simulation runs with implicit solvent representation in which solvent screening effects were represented by the use of a sigmoidal distance-dependent dielectric function. In the latter case, the system was simulated under microcanonical (N, V, E) and canonical (N, V, T) conditions. For the fully hydrated system simulation, a preequilibration protocol was developed since it was observed that long and progressive periods of heating and equilibration on the overall system were necessary in order to avoid energetic collisions between the solute and the solvent molecules, leading to severe irreversible deformation of the solute. A detailed analysis of DNA conformations, sugar puckers, and stability of the hydrogen bonds, Watson-Crick and three-center H bonds, is reported. The results show that DNA remains essentially in the B conformer with a tendency in the hydrated model to adopt a slightly distorted, unwound, and stretched conformation in comparison to standard B-DNA. Concerning sugar puckers, the mean pseudorotation phases of the adenine residues are systematically higher than those of the thymine residues, except in the case of the hydrated model for which a articular behavior is observed for the adenine strand. In this case, the terminal bases oscillate between C2'-endo and O4'-endo and the central ones stay in the C3'-endo domain. The mean lifetimes of the internal Watson-Crick H-bond (A) HN6...O4(T) are also dependent on the base pairs included in the calculation, excepted for the implicit solvent simulation at constant temperature. The three-center H bonds have very small mean lifetimes in all three cases of MD simulation. In the minor groove of the hydrated model, a spine of hydration is found as observed by x-ray crystallography and other theoretical simulations. On the basis of the rms deviations, it appears that the fully hydrated simulation has not reached a plateau at the end of the run, while the implicit simulation at constant energy seems to have converged. At constant temperature, very large oscillations in rms deviations are observed.

Base Sequence↗

PubMed1993

Differential stability of beta-sheets and alpha-helices in beta-lactamase: a high temperature molecular dynamics study of unfolding intermediates.

beta-Lactamase, which catalyzes beta-lactam antibiotics, is prototypical of large alpha/beta proteins with a scaffolding formed by strong noncovalent interactions. Experimentally, the enzyme is well characterized, and intermediates that are slightly less compact and having nearly the same content of secondary structure have been identified in the folding pathway. In the present study, high temperature molecular dynamics simulations have been carried out on the native enzyme in solution. Analysis of these results in terms of root mean square fluctuations in cartesian and [phi, psi] space, backbone dihedral angles and secondary structural hydrogen bonds forms the basis for an investigation of the topology of partially unfolded states of beta-lactamase. A differential stability has been observed for alpha-helices and beta-sheets upon thermal denaturation to putative unfolding intermediates. These observations contribute to an understanding of the folding/unfolding processes of beta-lactamases in particular, and other alpha/beta proteins in general.

Enzyme Stability↗

PubMed1992

Toward a dynamical structure of DNA: comparison of theoretical and experimental NOE intensities.

Comparisons of experimental and calculated interproton nuclear Overhauser effect (NOE) buildup curves for duplex d(CGCGAATTCGCG)2 have been made. The calculated NOEs are based on molecular dynamics simulations including counterions and water and on the single-structure canonical A, B, and crystal forms. The calculated NOE effects include consideration of the motions of individual interproton vectors and the anisotropic tumbling of the DNA. The effects due to inclusion of anisotropic tumbling are much larger than those due to the local motion, and both improve the agreement between calculated and experimental results. The predictions based on the dynamical models agree significantly better with experiment than those based on either of the canonical forms or the crystal structure.

Base Sequence↗