PubMed Health⌕ Search

Biomedical subjects

D M Gray

Publications and source records attributed to D M Gray.

At least 37 records · Page 2Linked to original sources
PubMed1994

Evidence from CD spectra that d(purine).r(pyrimidine) and r(purine).d(pyrimidine) hybrids are in different structural classes.

CD spectra and difference CD spectra of four d(oligopurine).r(oligopyrimidine) and four r(oligopurine).d(oligopyrimidine) hybrid duplexes containing mixed A.T(U) and G.C base pairs were compared with the spectra of four DNA.DNA and four RNA.RNA oligomer duplexes of similar repeating sequences. The 16 duplexes were formed by mixing oligomers that were 24 nucleotides long. The buffer was 0.05 M Na+ (phosphate), pH 7.0. DNA.DNA and RNA.RNA oligomer duplexes were used as reference B-form and A-form structures. We found that the CD spectra of d(purine).r(pyrimidine) and r(purine).d(pyrimidine) hybrid duplexes were different from the CD spectra of either DNA.DNA or RNA.RNA duplexes. The data suggested that these hybrids have intermediate structures between A-form RNA and B-form DNA structures. The CD spectra of d(purine).r(pyrimidine) and r(purine).d(pyrimidine) hybrid duplexes were different from each other, but the hybrids in each class had consistent CD spectra as indicated by nearest-neighbor comparisons. Thus, it appeared that the two types of hybrids belonged to different structural classes. The negative 210 nm band found in difference CD spectra was correlated with the presence of an r(purine) strand in the hybrid duplexes. The melting temperatures (Tm values) of these hybrids were compared with the Tm values of the DNA.DNA and RNA.RNA duplexes. The order of the thermal stability was: RNA.RNA duplex > r(purine).d(pyrimidine) hybrid > DNA.DNA duplex > d(purine).r(pyrimidine) hybrid, when comparing analogous sequences.

Base Composition↗
PubMed1993

Characterization of the Pf3 single-strand DNA binding protein by circular dichroism spectroscopy.

We have used circular dichroism (CD) spectroscopy and gel electrophoresis to characterize the single-strand DNA binding protein (ssDBP) of the bacteriophage Pf3 and its complexes with Pf3 DNA and various DNA and RNA homopolymers. The secondary structure of Pf3 ssDBP had < 1% alpha-helix and therefore was probably a beta-sheet structure like the fd gene 5 protein (g5p). From CD titrations, the binding stoichiometry of Pf3 ssDBP was two nucleotides per protein monomer (n = 2) for complexes formed with all of the nucleic acids except poly[r(U)], for which n = 3 (in a buffer of 10 mM Tris-HCl and 70 mM NaCl, pH 8.2). Evidence of an additional binding mode of n = 4 for complexes formed with Pf3 DNA was found by gel electrophoresis experiments. Pf3 ssDBP showed a marked sequence dependence in binding affinities similar to that known for the fd g5p.

Bacteriophages↗
PubMed1993

Evidence for a salt-induced conformational transition in UV-irradiated superhelical PM2 DNA.

Upon treatment with UV irradiation, native (supercoiled) PM2 DNA undergoes an increase in electrophoretic mobility relative to the nicked circular form in the presence of 1 M NaCl or 5 mM CaCl2 or MgCl2. This effect is dependent upon supercoiling in that the relative electrophoretic mobility decreases with decreasing superhelical density of the molecule. These findings indicate that supercoil-dependent aspects of the secondary and tertiary structure of nonirradiated PM2 DNA can be altered by a combination of UV irradiation and any of the ionic environments above. We show that the alteration is not the result of a conversion of Z-DNA segments to a right-handed helix or to a renaturation of denatured regions in PM2 DNA. Circular dichroism studies do not support a simple model in which A-form DNA induced by superhelical stress is converted to B-form DNA by UV-induced photodamage and salt. We, therefore, present three alternative explanations for these observations two of which invoke conformational transitions in secondary structure and a third which requires a change in tertiary structure due to an increase in flexibility.

Bacteriophages↗
PubMed1993

CD spectral comparisons of the acid-induced structures of poly[d(A)], poly[r(A)], poly[d(C)], and poly[r(C)].

CD spectra were used to compare the acid-induced structural transitions of poly[d(A)] and poly[d(C)] with those of poly[r(A)] and poly[r(C)], respectively. The types of base pairing were probably the same in the acid self-complexes of both A-containing polymers and in the acid self-complexes of both C-containing polymers. Similar base pairings were indicated by similarities in the difference CD spectra showing the changes during the first major acid-induced transitions of the polymers. Information from the CD spectra and pKa values of the transitions suggested that the transitions for the RNA polymers involved similar structural changes. The two DNA polymers were markedly different. Single-stranded poly[d(A)] was in the most stacked structure and had the lowest pKa for forming an acid self-complex. Single-stranded poly[d(C)] was in the least stacked structure and had the highest pKa for forming a protonated duplex.

Base Composition↗
PubMed1992

Flow linear dichroism spectra of four filamentous bacteriophages: DNA and coat protein contributions.

In this study, we have separated the contributions of DNA and protein to the absorption and linear dichroism (LD) of each of four phages: fd, IKe, Pf1, and Pf3. We have found that the DNA packaged in each of the phages is hypochromic relative to the purified single-stranded DNA, suggesting that bases are stacked in all of the phages. We have oriented the phages by flow and for the first time report the intrinsic LD from 320 to 190 nm for each of these phages. From the intrinsic LD of the phages and the isotropic absorption of the individual components, we have determined the reduced dichroism of the DNA within the phages and, subsequently, the maximum angle of inclination of the DNA bases (from the helix axis) for the packaged DNA. The maximum angles were 63 degrees and 64 degrees for the DNAs of class I phages fd and IKe, respectively. The angles were significantly less, 51 degrees and 49 degrees, for the DNAs of the class II phages Pf1 and Pf3, respectively. Thus, the two classes of phage differ in the structures of their packaged DNA, the DNA bases of the class II phages being more parallel to the long axis of the phage than are the DNA bases of the class I phages.

Bacteriophages↗
PubMed1992

Analysis of an RNA pseudoknot structure by CD spectroscopy.

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.

Base Composition↗
PubMed1991

Vacuum UV CD spectra of homopolymer duplexes and triplexes containing A.T or A.U base pairs.

Vacuum UV circular dichroism (CD) spectra were measured down to 174 nm for five homopolymers, five duplexes, and four triplexes containing adenine, uracil, and thymine. Near 190 nm, the CD bands of poly[d(A)] and poly[r(A)] were larger than the CD bands of the polypyrimidines, poly[d(T)], poly[d(U)], and poly[r(U)]. Little change was observed in the 190 nm region upon formation of the duplexes (poly[d(A).d(T)], poly[d(A).d(U)], poly[r(A).d(T)], poly[r(A).d(U)], and poly[r(A).r(U)]) or upon formation of two of the triplexes (poly[d(T).d(A).d(T)] and poly[d(U).d(A).d(U)]). This showed that the purine strand had the same or a similar structure in these duplexes and triplexes as when free in solution. Both A.U and A.T base pairing induced positive bands at 177 and 202 nm. For three triplexes containing poly[d(A)], the formation of a triplex from a duplex and a free pyrimidine strand induced a negative band centered between 210 and 215 nm. The induction of a band between 210 and 215 nm indicated that these triplexes had aspects of the A conformation.

Base Composition↗
PubMed1991

A method for estimating the nearest neighbor base-pair content of RNAs using CD and absorption spectroscopy.

CD and absorption spectra are sensitive to the secondary structure of RNAs. By fitting the spectra contained in our basis set to the CD and absorption spectra of an RNA of known sequence, we could determine the fractions of base pairs, the fractions of each of the nearest neighbor base pairs, and the fractions of the single-stranded nucleotides in that RNA. The basis set included 58 CD and 58 absorption spectra. The fitting was done with a guided selection routine. The estimated error was about 0.05 for predicting the fractions of the nearest neighbor base pairs, 0.06 for predicting the fractions of A.U, G.C, and G.U base pairs, and 0.04 for predicting the fractions of the single-stranded nucleotides.

Base Composition↗
PubMed1991

An estimate of the nearest neighbor base-pair content of 5S RNA using CD and absorption spectroscopy.

We analyzed the CD and uv absorption spectra of 5S RNA from Escherichia coli using the method developed in the preceding paper. The analysis of spectra of 5S RNA at 20 degrees C in 0.1M NaClO4, 2.5 mM Na+ (phosphate), pH 7.0, and 0.5 mM MgSO4 gave 7 +/- 3.6 A.U base pairs, 25 +/- 3.6 G.C base pairs, and 7.5 +/- 3.6 G.U base pairs. Estimates of nearest neighbor base pairs were more consistent with the Pieler-Erdmann and the Gewirth-Moore secondary structure models than with the Fox-Woese or the Burns-Luoma-Marshall models. We also examined the structure of 5S RNA as a function of temperature. The melting profile exhibited two transitions--one at about 35 degrees C and one above 50 degrees C. Our spectral data showed that helices I and II were stable during the first transition, and agreed with other data that helix III was the most likely helix to have melted. The results from this in-depth study of 5S RNA indicate that our method of analysis should be useful for studying the secondary structures of other small, unmodified RNAs.

Base Composition↗
PubMed1990

CD evidence that the alternating purine-pyrimidine sequence poly[d(A-C).d(G-T)], but not poly[d(A-T).d(A-T)], undergoes an acid-induced transition to a modified secondary conformation.

Circular dichroism and UV absorption data showed that poly[d(A-C).d(G-T)] (at 0.01M Na+ (phosphate), 20 degrees C) underwent two reversible conformational transitions upon lowering of the pH. The first transition was complete at about pH 3.9 and resulted in an acid form of the polymer that was most likely a modified, protonated duplex. The second transition occurred between pH 3.9 and 3.4 and consisted of the denaturation of this protonated duplex to the single strands. UV absorption and CD data also showed that the separated poly[d(A-C)] strand formed two acid-induced self-complexes with pKa values of 6.1 and 4.7 (at 0.01M Na+). However, neither one of these poly[d(A-C)] self-complexes was part of the acid-induced rearrangements of the duplex poly[d(A-C).d(G-T)]. Acid titration of the separated poly[d(G-T)] strand, under similar conditions, did not show the formation of any protonated poly[d(G-T)] self-complexes. In contrast to poly[d(A-C).d(G-T)], poly[d(A-T).d(A-T)] underwent only one acid-induced transition, which consisted of the denaturation of the duplex to the single strands, as the pH was lowered from 7 to 3.

Base Sequence↗
PubMed1990

The vacuum UV CD bands of repeating DNA sequences are dependent on sequence and conformation.

CD spectra were obtained for eight synthetic double-stranded DNA polymers down to at least 175 nm in the vacuum uv. Three sets of sequence isomers were studied: (a) poly[d(A-C).d(G-T)] and poly[d(A-G).d(C-T)], (b) poly[d(A-C-C).d(G-G-T)] and poly[d(A-C-G).d(C-G-T)], and (c) poly[d(A).d(T)], poly[d(A-T).d(A-T)], poly[d(A-A-T).d(A-T-T)], and poly[d(A-A-T-T).d(A-A-T-T)]. There were significant differences in the CD spectra at short wavelengths among each set of sequence isomers. The (G.C)-containing sequences had the largest vacuum uv bands, which were positive and in the wavelength range of 180-191 nm. There were no large negative bands at longer wavelengths, consistent with the polymers all being in right-handed conformations. Among the set of sequences containing only A.T base pairs, poly[d(A).d(T)] had the largest vacuum uv CD band, which was at 190 nm. This CD band was not present in the spectra of the other (A.T)-rich polymers and was absent from two first-neighbor estimations of the poly[d(A).d(T)] spectrum obtained from the other three sequences. We concluded that the sequence dependence of the vacuum uv spectra of the (A.T)-rich polymers was due in part to the fact that poly[d(A).d(T)] exists in a noncanonical B conformation.

Base Composition↗
PubMed1990

A.U and G.C base pairs in synthetic RNAS have characteristic vacuum UV CD bands.

The vacuum UV CD spectra of GpC, CpG, GpG, poly[r(A)], poly[r(C)], poly[r(U)], poly[r(A-U)], poly[r(G).r(C)], poly[r(A).r(U)], and poly[r(A-U).r(A-U)] were measured down to at least 174 nm. These spectra, together with the published spectra of poly[r(G-C).r(G-C)], CMP, and GMP, were sufficient to estimate the CD changes upon base pairing for four double-stranded RNAs. The vacuum UV CD bands of poly[r(A)], poly[r(C)], and the dinucleotides GpC and CpG were temperature dependent, suggesting that they were due to intrastrand base stacking. The dinucleotide sequence isomers GpC and CpG had very different vacuum UV CD bands, indicating that the sequence can play a role in the vacuum UV CD of single-stranded RNA. The vacuum UV CD bands of the double-stranded (G.C)-containing RNAs, poly[r(G).r(C)] and poly[r(G-C).r(G-C)], were larger than the measured or estimated vacuum UV CD bands of their constituent single-stranded RNAs and were similar in having an exceptionally large positive band at about 185 nm and negative bands near 176 and 209 nm. These similarities were enhanced in difference-CD spectra, obtained by subtracting the CD spectra of the single strands from the CD spectra of the corresponding double strands. The (A.U)-containing double-stranded RNAs poly[r(A).r(U)] and poly[r(A-U).r(A-U)] were similar only in that their vacuum UV CD spectra had a large positive band at 177 nm. The spectrum of poly[r(A).r(U)] had a shoulder at 188 nm and a negative band at 206 nm, whereas the spectrum of poly[r(A-U).r(A-U)] had a positive band at 201 nm. On the other hand, difference spectra of both of the (A.U)-containing polymers had positive bands at about 177 and 201 nm. Thus, the difference-CD spectra revealed CD bands characteristic of A.U and G.C base pairing. (ABSTRACT TRUNCATED AT 250 WORDS)

Base Composition↗
PubMed1990

A.T and C.C+ base pairs can form simultaneously in a novel multistranded DNA complex.

Previous experiments have established that in certain synthetic oligomeric DNA sequences, including mixtures of d(AACC)5 with d(CCTT)5, adenine-thymine (A.T) base pairs form to the exclusion of neighboring protonated cytosine-cytosine (C.C+) base pairs [Edwards, E., Ratliff, R., & Gray, D. (1988) Biochemistry 27, 5166-5174]. In the present work, circular dichroism and other measurements were used to study DNA oligomers that represented two additional classes with respect to the formation of A.T and/or C.C+ base pairs. (1) One class included two sets of repeating pentameric DNA sequences, d(CCAAT)3-6 and d(AATCC)4,5. For both of these sets of oligomers, an increase in the magnitude of the long-wavelength positive CD band centered at about 280 nm occurred as the pH was lowered from 7 to 5 at 0.1 and 0.5 M Na+, indicating that C.C+ base pairs formed. Even though it may have been possible for these oligomers to form duplexes with two antiparallel A.T base pairs per pentamer, no A.T base pairing was detected by monitoring the CD changes at 250 nm. Thus, spectral data showed that as few as 40% C.C+ base pairs were stable in two sets of oligomers in which A.T base pairs did not form adjacent to, or in place of, C.C+ base pairs. (2) Another class of oligomer was represented by d(C4A4T4C4), which was studied by CD, HPLC, and centrifugation experiments. We confirmed previous work that this sequence was able to form both types of base pairs as the pH and temperature were lowered [Gray, D., Cui, T., & Ratliff, R. (1984) Nucleic Acids Res. 12, 7565-7580].(ABSTRACT TRUNCATED AT 250 WORDS)

Adenine↗
PubMed1989

CD measurements show that fd and IKe gene 5 proteins undergo minimal conformational changes upon binding to poly(rA).

Circular dichroism (CD) measurements were made on both fd and IKe gene 5 proteins in solution. The difference between the CD spectra of these two proteins was interpreted as being the result of an enhanced tyrosine contribution in the IKe gene 5 protein spectrum. There was no spectral evidence for significant alpha-helical structures in either of the two gene 5 proteins. CD measurements were also made on complexes of the two gene 5 proteins with poly(rA). The long-wavelength region (300-250 nm) of the CD spectra of both complexes was essentially like that of free poly(rA) at a high temperature. With the assumption that the poly(rA) components of the complexes had the same CD at all wavelengths as did free poly(rA) at a high temperature, it was possible to separate the CD spectra of the complexes into protein and nucleic acid components. Except for the tyrosine CD band at 229 nm, there were no significant changes in the CD bands of either protein upon binding to poly(rA). Thus, each protein appeared to maintain essentially the same overall secondary conformation when complexed with poly(rA) as when in its free state.

Circular Dichroism↗
PubMed1989

13C NMR of methylated lysines of fd gene 5 protein: evidence for a conformational change involving lysine 24 upon binding of a negatively charged lanthanide chelate.

Helical complexes formed between fd DNA and reductively methylated fd gene 5 protein were indistinguishable by electron microscopy from complexes formed with the nonmethylated protein. 13C NMR spectroscopy of 13C-enriched N epsilon, N epsilon-dimethyllsyl residues of the protein showed that three of these residues (Lys-24, Lys-46, and Lys-69) were selectively perturbed by binding of the oligomer d(pA)7. These were the same lysyl residues that we previously found to be most protected from methylation by binding of the protein to poly[r(U)] [Dick, L. R., Sherry, A. D., Newkirk, M. M., & Gray D. M. (1988) J. Biol. Chem. 263, 18864-18872]. Thus, these lysines are probably directly involved in the nucleic acid binding function of the protein. Negatively charged chelates of lanthanide ions were used to perturb the 13C NMR resonances of labeled lysyl and amino-terminal residues of the gene 5 protein. The terbium chelate was found to bind tightly (Ka approximately 10(5) M-1) to the protein with a stoichiometry of 1 chelate molecule per protein dimer. 13C resonances of Lys-24, Lys-46, and Lys-69 were maximally shifted by the terbium chelate and were maximally relaxed by the gadolinium chelate. Also, the terbium chelate was excluded by the oligomer d(pA)7. Computer fits of the induced chemical shifts of 13C resonances with those expected for various positions of the terbium chelate failed to yield a possible chelate binding site unless the chemical shift for Lys-24 was excluded from the fitting process.(ABSTRACT TRUNCATED AT 250 WORDS)

Bacteriophages↗
PubMed1989

A CD determination of the alpha-helix contents of the coat proteins of four filamentous bacteriophages: fd, IKe, Pf1, and Pf3.

The CD spectra of four filamentous bacteriophages--fd, IKe, Pf1, and Pf3--were analyzed to determine the alpha-helix contents of their major coat proteins. Measured spectra included the 192-nm band so that analyses could be carried out over the full wavelength range of the reference spectra for protein secondary structures available (a) from globular proteins [J.T. Yang, C.S.C. Wu, and H.M. Martinez (1986) Methods in Enzymology 130, 208-269] and (b) from poly(L-lysine) [N. Greenfield and G.D. Fasman (1960) Biochemistry 8, 4108-4116]. Extended analyses were also performed with the addition of the spectrum of a model beta-turn to the Greenfield and Fasman reference set, with the spectrum of a short alpha-helix in the Yang et al. reference set, and with an estimate of the spectrum of Trp added to both reference sets. The reference set based on the simple poly(L-lysine) polypeptide, plus a spectrum of a model beta-turn or of Trp, gave reasonably good fits to the measured spectra for all four phages and yielded the largest percentages of alpha-helix. The class I phages--fd and IKe--had large percentages of alpha-helix of 98 +/- 2 and 97 +/- 5%, respectively, while the two class II phages--Pf1 and Pf3--had similar but smaller alpha-helix contents of 83 +/- 6 and 84 +/- 2, respectively. While these alpha-helix contents were within the ranges previously reported from CD spectra of these phages in solution, they were more precise, and they indicated that the coat proteins of the intact phages have CD spectra that are probably modeled better by the reference spectra of polypeptides than by those of globular proteins.

Bacteriophages↗
PubMed1989

Specificity of the binding of fd gene 5 protein to polydeoxyribonucleotides.

The long-wavelength circular dichroism (CD) changes induced by binding of fd gene 5 protein to the alternating DNA sequences poly[d(A-C)] and poly[d(C-T)] were similar to those induced by the protein complexed with the homopolymers poly[d(A)], poly[d(C)], and poly[d(T)]. The fd gene 5 protein showed different binding affinities for the various polymers. The affinity for the alternating sequences was not compositionally weighted with respect to the affinities for the homopolymers, indicating that both base composition and base sequence of the template are important for the binding of fd gene 5 protein.

Bacteriophages↗