PubMed Health⌕ Search

Biomedical subjects

D Z Staynov

Publications and source records attributed to D Z Staynov.

18 recordsLinked to original sources
PubMed1995

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Base Sequence↗
PubMed1994

Regulation of interleukin-5 and granulocyte-macrophage colony-stimulating factor expression.

This review concerns the regulation of expression of the two main eosinophil differentiating factors, interleukin-5 (IL-5) and granulocyte-macrophage colony-stimulating factor (GM-CSF). The latter, GM-CSF, is expressed in a wide variety of differentiated and non-differentiated cell types: T cells, monocytes, macrophages, fibroblasts, and endothelial cells. On the other hand, IL-5 is only expressed by a limited number of fully differentiated cells: eosinophils, mast cells, and a subset of T cells. Activation of GM-CSF in T cells and non-T cells occurs by different mechanisms, regulated both transcriptionally and post-transcriptionally. The transcriptional activation of GM-CSF via protein kinase C pathway and via viral transactivating proteins involves different regulatory elements of its promoter. Although one of these cis acting elements is common to IL-5, the activation of IL-5 apparently proceeds via different mechanism(s).

Animals↗
PubMed1994

Chemical mutational analysis of the human glucocorticoid receptor cDNA in glucocorticoid-resistant bronchial asthma.

Corticosteroid-resistant (CR) asthma is not caused by altered bioavailability of the administered drug, altered ligand-binding characteristics, or altered nuclear translocation of the activated human glucocorticoid receptor (hGR) complex. We have tested the hypothesis that CR asthma results from a consistent polymorphism in the functionally diverse hGR cDNA using the sensitive screening technique of polymerase chain reaction (PCR) amplification and chemical mutational analysis. Total RNA was extracted from peripheral blood monocytes derived from six corticosteroid-sensitive (CS) and six CR asthmatic subjects. The RNA was reverse transcribed, and overlapping hGR cDNA fragments were amplified by nested PCR. Double-stranded hGR cDNA fragments were hybridized to corresponding 32P-5'-labeled wild-type fragments, chemically modified with osmium and hydroxylamine, and cleaved with piperidine. The resultant cleaved strands were detected by autoradiography. As controls, single base pair mutated hGR cDNA fragments sensitive to hydroxylamine and osmium modification were used. Using this technique, we did not detect any base pair mismatch between the six CS and six CR patients and the corresponding wild-type hGR, despite a 100% detection of control mutations. We conclude that the defect in CR asthma does not lie in the structure of the hGR.

Adult↗
PubMed1992

Expression of interleukin-5 and granulocyte-macrophage colony-stimulating factor in human peripheral blood mononuclear cells after activation with phorbol myristate acetate.

The expression of interleukin-5 (IL-5) and granulocyte-macrophage colony-stimulating factor (GM-CSF) was studied in peripheral blood mononuclear cells (PBMC) from atopic and non-atopic subjects after activation with phorbol 12-myristate 13-acetate (PMA). The levels of IL-5 and GM-CSF mRNA were monitored by quantitative polymerase chain reaction (PCR). IL-5 and GM-CSF mRNA was undetectable in quiescent cells. Following PMA stimulation, some atopic patients showed considerably higher levels of IL-5 and GM-CSF mRNA expression than the non-atopic subjects, and there was a significant correlation between the levels of these two cytokines. It was found that activation of IL-5 expression in PBMC requires protein synthesis as does activation of GM-CSF expression, and that PMA is only required during the first few hours of activation. The kinetics of activation indicated that the level of both mRNA increased over 15 hr and remained constant for another 20 hr. The accumulation of IL-5 mRNA lagged about 3 hr behind GM-CSF mRNA accumulation, suggesting that the expression of these two genes is regulated separately. However, GM-CSF expression was not required for IL-5 activation.

Adult↗
PubMed1988

Footprinting of linker histones H5 and H1 on the nucleosome.

DNase I has been used to footprint the linker histones H5 and H1 on the nucleosome of chicken erythrocyte chromatin. Rate constants have been derived for digestion at the principal sites of attack on chromatosome length DNA (168 bp), located about 10 bp apart, and compared with those observed for linker histone-depleted chromatosomes. Complete protection was found for site S7 on the dyad axis and decreasing partial protection seen at symmetrically positioned sites on each side of S7. Strong, but not complete protection was noted at S14, the site corresponding to the end of the core particle, situated less than 1/4 of a turn away from the dyad. Uniform partial protection was observed for sites S2, S3, S4 and S10, S12 on the far side of the chromatosome. The simplest interpretation of these results is that the globular domain of H5/H1 is responsible for the protection at S7, whilst extended N- and C-domains give rise to the partial protection at sites away from the dyad axis.

Animals↗
PubMed1983

Nuclease digestion patterns as a criterion for nucleosome orientation in the higher order structure of chromatin.

Nuclease digestion patterns have been used to discriminate between possible orientations of nucleosomes in the higher order structure of chromatin. Computer simulations were done assuming 3 basically different orientations of nucleosomes which include all proposed models for the '30 nm fibre'. It is found that only alternating exposure of consecutive nucleosomes can explain the DNase I and DNase II digestion patterns.

Animals↗
PubMed1980

Interparticle effects in low-angle x-ray and neutron diffraction from chromatin.

Published diffraction data are critically reviewed, and replotted in a new way to show the variation with concentration of the 8- to 25- nm diffraction maximum. Most of the early data are found to be consistent with a single model for a liquid-type array of mutually repulsive particles, whose molecular weight is calculated to be that of a nucleosome or possibly a dimer. The data for all but the highest concentrations, where distortion due to dehydration is possible, support no particular model for the higher-order coiling of chains of nucleosomes, and cannot be used to support models for "native" chromatin. Only in the presence of excess salts or after isolation with polyamines is there aggregation in solution of nucleosomes, which then give peaks at 11 and 5.5 nm that do not change much with concentration. Recent work by the authors confirms that under some conditions nucleosome undergo a transition to a state whose diffraction is consistent with hexagonal packing of extended DNA to which histones are still attached. This state is probably responsible for much of the strong 2.7-nm peak previously obtained from certain samples, which was in some cases assigned to nucleosome structure. Only the peak at 3.7 nm is clearly attributable to the form factor of the isolated native nucleosome.

Animals↗
PubMed1980

Reversible dissociation of linker histone from chromatin with preservation of internucleosomal repeat.

Procedures are described for the dissociation of histones H1 and H5 from chicken reticulocyte chromatin without disruption of the native core histone-DNA complex. The comparative properties of native and depleted chromatin with respect to sedimentation, thermal denaturation, and sensitivity to nuclease digestion have been studied. The changes in these properties resulting from removal of the linker histones are fully reversed when histone H5 is added back to the depleted chromatin.

Animals↗
PubMed1977

Size and turnover of polyadenylic acid-containing ribonucleic acids in a fragile mutant of Saccharomyces cerevisiae.

Ribonucleic acid-containing polyadenylic acid [poly(A)+-RNA] was studied in lysates from an osmotic-sensitive mutant of Saccharomyces cerevisiae characterized by low nuclease activity. The poly(A)+-RNA fraction, analyzed by electrophoresis in polyacrylamide-formamide gels, constitutes a heterogeneous population of molecules, with molecular weights ranging from 0.2 X 10(6) to 3 X 10(6) and having an average of 1.2 X 10(6). The turnover rate of poly(A)+-RNA was determined by the decay of radioactivity after a cold uracil chase, and the observed half-life of 21 min corresponds to about 10% of the cell doubling time. Poly(A)+-RNA was analyzed by gel electrophoresis under denaturing and non-denaturing conditions. A correlation was established between the apparent secondary structure and the turnover rate of poly(A)+-RNA species.

Electrophoresis, Polyacrylamide Gel↗
PubMedDate not supplied

A conserved motif in the promoters of several cytokines expressed by human Th2-type lymphocytes.

We have recently found a novel conserved motif in the promoters of several T-cell-expressed cytokines [human interleukin-2, -4, -5 and -13 and human and mouse granulocyte/macrophage-colony stimulating factor (GM-CSF)]. It contains a core sequence CTTGG ... CCAAG which is present as part of larger palindromic sequences in each gene. This suggest that they may interact with a new family of trans-acting factors. In transfection assays, the human GM-CSF element has a strong positive effect on the expression of a reporter gene by the human T cell line Jurkat J6 upon stimulation. In DNA mobility shift assays, this sequence can give either six different specific bands which are competed out by different parts of the sequence or one specific band which is competed out by each of the inverted repeats, depending on the reconstitution conditions. In different genes, the core sequences are separated by integer numbers of helical turns. Considering the strong positive regulatory effect of this element and its presence in several T-cell-expressed cytokine genes, it may be crucial to the coordinated expression of these cytokines in T helper cells.

Animals↗