PubMed Health⌕ Search

Biomedical subjects

E Baker

Publications and source records attributed to E Baker.

At least 73 records · Page 4Linked to original sources

Characterisation of non-transferrin-bound iron (ferric citrate) uptake by rat hepatocytes in culture.

Under conditions of iron overload plasma transferrin can be fully saturated and the plasma can transport non-transferrin-bound Fe which is rapidly cleared by the liver. Much of this Fe is complexed by citrate. The aim of the present work was to characterise the mechanisms by which Fe-citrate is taken up by hepatocytes using a rat hepatocyte cell culture model. The cells, after one day in culture, were incubated with 59Fe-labelled Fe-citrate for varying time periods, then washed and Fe uptake to the membrane and intracellular compartments of the cell was determined by radioactivity measurements. Maximal rates of internalisation of Fe occurred at a Fe:citrate molar ratio of 1:100 or greater, a pH of approximately 7.4 and an extracellular Ca2+ concentration of 1.0 mM. Fe uptake showed Michaelis-Menten kinetics and was a temperature-dependent process. The K(m) and Vmax for Fe internalisation by the cells at 37 degrees C were approximately 7 microM and 2 nmol/mg DNA/min (25 x 10(6) atoms/cell/min), respectively; and the Arrhenius activation energy was 35 kJ/mol. The transition metals, Zn2+, Co2+ and Ni2+, inhibited Fe uptake when used at 10 and 100 times the concentration of Fe. The rate of Fe internalisation from Fe-citrate was found to be approximately 20 times as great as that from Fe-transferrin with Fe concentrations of 1 and 2.5 microM for both forms of Fe. The rate of Fe uptake by iron-loaded hepatocytes obtained from rats which had been fed carbonyl Fe was not significantly different from that by normal hepatocytes. These experiments show that rat hepatocytes in primary culture have a high capacity to take up non-transferrin-bound Fe in the form of Fe-citrate and that uptake occurs by facilitated diffusion. The iron transport process does not appear to be regulated by cellular Fe levels.

Animals↗

Peritumoral CD1a-positive dendritic cells are associated with improved survival in patients with tongue carcinoma.

OBJECTIVES: To determine if survival and recurrence rates for patients with squamous cell carcinoma of the tongue correlate with the degree of dendritic cell (DC) infiltration of the primary tumor or adjacent tongue tissue and if there is an association between tumor or nodal stage and DC infiltration. DESIGN: Hospital and office medical records were reviewed to obtain 5-year follow-up data. Original pathology specimens were recut and stained for the cell surface markers S100 and CD 1a. The number of DCs present in the specimens was quantified microscopically and compared statistically with patient outcome and staging. SETTING: A university hospital. PATIENTS: All patients who underwent resection of primary squamous cell carcinoma of the tongue from January 1, 1987, through December 31, 1990, for whom 5-year follow-up data and original pathology specimens were available (N=43). MAIN OUTCOME MEASURES: Time to recurrence, death, or both. RESULTS: Patients who had greater numbers of CD1a-positive DCs adjacent to tumor had improved survival (P=.02) and decreased recurrence rates (P=.06). The other subpopulations of DCs examined were not associated with survival or recurrence. In addition, the number of CD 1a-positive DCs in peritumoral epithelium decreased as the tumor stage increased (P=.01) and if nodal metastases were present (P=.05). CONCLUSIONS: Dendritic cells are antigen-presenting cells that are thought to play a major role in the antitumor immune response. The CD1a surface antigen has been shown to mediate T-cell interactions. The association between CD1a-positive peritumoral DCs and patient outcome suggests an important function for this cell population.

Adult↗

Prenatal failure to visualize kidneys: a spectrum of disease.

OBJECTIVES: To better understand the outcomes and management of patients when there is a failure to visualize kidneys on prenatal ultrasound. METHODS: Nine thousand five hundred twelve prenatal ultrasound studies performed on 4900 patients were reviewed retrospectively for the findings of a failure to visualize kidneys. The prenatal ultrasounds, pregnancy outcomes, and postmortem studies were reviewed for each of the 10 patients identified. RESULTS: Nine of 10 patients experienced fetal death in the index pregnancy: 7 had therapeutic abortions, 1 had an intrauterine fetal demise, and 1 gave birth to a stillborn infant. One patient gave birth to a live infant with Bartter's syndrome and grossly normal kidneys, as diagnosed by ultrasound. Developmental renal anomalies were identified in only 4 of 10 cases, and only 2 patients had true bilateral renal agenesis. There was 1 case each of bilateral renal medullary cystic dysplasia and bilateral renal hypoplasia. Three cases had no renal anomalies and included 1 case each of Turner's syndrome, chronic abruption, and a cord accident. In 2 cases, postmortem examinations were not performed because of family wishes. CONCLUSIONS: Prenatal failure to visualize kidneys represents a spectrum of clinical problems not all of which are fatal. Close consultation with an experienced ultrasonographer is essential to provide informed counseling to expectant parents. Pathologic examination should be recommended when there is fetal demise and a suspicion of genitourinary anomalies. Screening of family members of the index patient and genetic counseling may be indicated.

Female↗

Characterisation of citrate and iron citrate uptake by cultured rat hepatocytes.

BACKGROUND/AIMS: The endogenous low molecular weight iron chelator, citrate, is considered to be an important contributor to iron transport and the liver the main site of uptake of iron citrate in subjects suffering from diseases of iron overload. Moreover, the citrate-metabolising enzyme, aconitase, is implicated in the regulation of cellular iron metabolism. This study was undertaken to determine the role of citrate and ferric citrate in the uptake of iron by rat hepatocytes. METHODS: Cultured rat hepatocytes were incubated (37 degrees C, 15 min) with 100 microM [14C]-citrate in the presence or absence of 1.0 microM 55Fe. Membrane-bound and intracellular radiolabel were separated by incubation with the general protease, Pronase. RESULTS: Our results suggest that ferric citrate uptake is mediated by a specific citrate binding site which exhibits a higher affinity for citrate in the presence of iron than in its absence. Citrate was internalised by hepatocytes, with at least 70% being oxidised to CO2 within 15 min. Citrate uptake was pH-dependent, did not require the presence of sodium and increased with increasing iron concentration. Metabolic energy, anion channels, the Na+, K+-ATPase and vesicle acidification do not appear to play a role in uptake of ferric citrate, but functional sulphydryl groups may be involved. CONCLUSIONS: The data suggest either that ferric citrate complexes with higher molar ratios of iron to citrate relative to the incubation medium are bound preferentially to the membrane, or that once citrate has delivered its iron to the membrane, the complex dissociates and the components are internalised separately.

Animals↗

Fragile sites still breaking.

Rare fragile sites on chromosomes are the archetypal dynamic mutations. They involve large expansions of the microsatellite CCG or AT-rich minisatellites. The mutation process is an increase in repeat-unit number from within a normal range, through a premutation range, up to full mutation where the fragile site is expressed. Full mutations can inactivate genes and are regions of genomic instability. Common fragile sites, in particular, might have a role in oncogensis by facilitating gene inactivation through chromosomal deletion or amplification, but this requires further exploration. The mechanisms behind the changes that give rise to the cytogenetic manifestation of chromosomal fragility are now beginning to be understood.

Chromosome Fragile Sites↗

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis.

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Alleles↗

Fourth module of Xenopus interphotoreceptor retinoid-binding protein: activity in retinoid transfer between the retinal pigment epithelium and rod photoreceptors.

PURPOSE: Interphotoreceptor retinoid-binding protein (IRBP), an extracellular protein believed to support the exchange of retinoids between the neural retina and retinal pigment epithelium (RPE) in the vertebrate eye, exhibits a modular, i.e., repeat, structure. The present study was undertaken to determine whether an individual module of IRBP has activity in retinoid transfer between the RPE and rod photoreceptors. METHODS: The retinoid transfer activity of a recombinant protein corresponding to the fourth module of Xenopus laevis IRBP (X4IRBP) was examined in two ways. First, X4IRBP was tested for its ability to support the regeneration of porphyropsin in detached/reattached Xenopus retina/RPE-eyecups. Following illumination and removal of native IRBP, Xenopus eyecups supplemented with 42 microM X4IRBP or (as a control) Ringer's solution were incubated in darkness and then analyzed for regenerated porphyropsin. Second, toad (Bufo marinus) RPE-eyecup preparations were used to evaluate X4IRBP's ability to promote the release of 11-cis retinal from the RPE. RESULTS: The regeneration of porphyropsin in X4IRBP-supplemented Xenopus retina/RPE-eyecups (0.45 +/- 0.04 nmol; mean +/- SEM, n = 11) exceeded that in controls (0.13 +/- 0.02 nmol, n = 11). For promoting the release of 11-cis retinal from the toad RPE, 42 microM X4IRBP was more effective than equimolar bovine serum albumin although considerably less than that of 26 microM native bovine IRBP. CONCLUSIONS: The results indicate a low but significant activity of IRBP's fourth module in reactions relevant to retinoid exchange.

Animals↗

Inactivation of p53 and amplification of cyclin D1 correlate with clinical outcome in head and neck cancer.

The authors have investigated whether genetic abnormalities in two genes, loss of heterozygosity (LOH) of p53 and amplification of the cyclin D1 gene, correlate with clinical outcome in 56 matched pairs of blood and tumor from patients with squamous cell carcinoma of the head and neck (SCCHN). Frequency of p53 LOH was 47.4%, of cyclin D1 amplification 33.9%, and of both abnormalities together 23.7%. p53 LOH was associated with T4 (P = 0.003) and stage IV (P = 0.015) tumors. Cyclin D1 amplification was associated with recurrences and/or metachronous tumors (P = 0.007). The total number of p53 and cyclin D1 abnormalities (scored as zero, one, and two) show a pattern that seems to be additive; the increase in the number of these abnormalities is associated with a proportional increase in the frequency of T4, stage IV, presence of recurrences and/or metachronous tumors, and possibly a proportional decrease in the disease-free interval in the sample. The association of the markers with recurrences and/or metachronous tumors persists if the tumor stage effect is mathematically removed. The combined analysis of the p53 and cyclin D1 abnormalities seems to be more informative than either of them individually and may have predictive value in SCCHN.

Carcinoma, Squamous Cell↗

The concept of an immune mechanism of chemical homeostasis and its importance in biology and medicine.

This paper outlines research that has led to the concept of the inevitable participation of the immune system in an organism's chemical homeostasis. This function of the immune system is tentatively named the 'immune mechanism of the chemical homeostasis' (IMCH). It is based on the theory of a permanent physiological synthesis of antibodies to endogenous biologically active substances. Minimal accumulation of biologically active substances as a result of the influence of different factors specifically activates the immune system in order to maintain its chemical homeostasis. The concept suggests the necessity of widening the notion of the range of the immune system's censorial functions. The concept explains the preexistence of immunocompetent cells preadapted to biologically active substances and autoantibodies specific to them; the natural clonality of the B lymphocyte pool; the polyclonal lymphocyte activation triggered by mitogens, foreign proteins, erythrocytes, and microbes, and tolerance to drugs.

Animals↗

Physical activity and minority women: a qualitative study.

Few physical activity research studies have been conducted with minority women. The purpose of this study was to explore patterns of physical activity among minority women. Focus groups were conducted with volunteers older than age 40. Each group was led by a trained moderator familiar with the ethnic community targeted. The sessions were audiotaped and professionally transcribed. Constructs were researched and codes were developed. Data were analyzed using NUD*IST qualitative analysis program. While participants did not identify themselves as "exercisers," they indicated they got enough physical activity from caregiving, housekeeping, and workday activities. The most common environmental barriers to becoming more physically active included safety, availability, and cost. Personal barriers included lack of time, health concerns, and lack of motivation. Results indicate the importance of terminology and assessment when conducting physical activity research in these populations. Also, results suggest many barriers are changeable with policies and interventions.

Adult↗

Evaluation of a primary care counselling service in Dorset.

BACKGROUND: Research into the effectiveness of counselling in primary care is rare. This study attempts to provide a thorough evaluation of the effects of a new counselling service introduced throughout Dorset. AIM: To evaluate the impact of counselling on client symptomatology, self-esteem, and quality of life. The effect of counselling on drug prescribing, referrals to other mental health professionals, and client and general practitioner (GP) satisfaction were also assessed. METHOD: All new clients referred for counselling were asked to complete and return questionnaires before and after counselling. A total of 385 clients took part in the study. The first and second assessments were compared statistically. Clients were ascribed a psychiatric diagnosis using a simplified version of DSM-IIIR (Diagnostic and Statistical Manual of the American Psychiatric Association). GPs' views of the service were determined using a specially designed questionnaire. Drug data were obtained from the Prescription Pricing Authority and referral statistics from Dorset HealthCare National Health Service (NHS) Trust. RESULTS: The number of psychiatric symptoms and their severity were significantly reduced by counselling. There were no significant differences in the prescription of anxiolytic/hypnotic and anti-depressant medication between matched practices with and without counsellors. The presence of a counsellor did not affect the rate of referral to other mental health professionals. Clients and GPs valued the service highly. CONCLUSIONS: The Psychology Managed Counselling Service is an effective method of running a counselling service and is well received by both clients and GPs. Counselled clients improved significantly on several measures.

Counseling↗

Learners' experience of continuing medical education events: a qualitative study of GP principals in Dorset.

BACKGROUND: General practitioners' (GPs') attendance at continuing medical education (CME) events has increased since the introduction of the Post Graduate Educational Allowance (PGEA) in 1990. However, few studies have examined doctors' perceptions about their continuing education, and explored their views in depth. AIM: To investigate general practitioners' experience of CME events, what personal impact they had, and how the GPs perceived the influence of CME in their professional practice and patient care. METHOD: A qualitative study, with in-depth semi-structured interviews, of a purposive sample of 25 general practitioners in Dorset was conducted. Content analysis was used to identify major themes from the transcripts. RESULTS: GPs perceived CME events as beneficial. Confidence levels rose, and the events provided a break from practice that refreshed and relaxed, thus indirectly benefiting patients. The opportunities provided by formal events for informal learning and exchange of ideas, with both peers in general practice and consultant colleagues, were highly valued. The relevance of the subject to general practice, and the appropriateness of the educational format, were considered of paramount importance. Few responders identified major changes in their practice as a result of formal CME events, and information was seldom disseminated among practice colleagues. CONCLUSION: The results of this study challenge GP educators to provide CME that is relevant, to recognize the value of peer contact, and to facilitate the incorporation of new information into practice.

Data Collection↗

Unbalanced t(4;11)(q32;q23) in a 34-year-old man with manifestations of distal monosomy 11q and trisomy 4q syndromes.

We present a 34-year-old man with an unbalanced translocation between the long arms of chromosome 4 and chromosome 11. He had manifestations of monosomy 11(q23)--minor facial anomalies, abnormal head shape, cryptorchidism; trisomy 4(q32)--hirsutism, renal disease; and manifestations attributable to both imbalances--heart disease, musculoskeletal anomalies, and mental retardation. FISH studies showed that the chromosome 11q23.3 translocation breakpoint was distal to the rare folate sensitive fragile site (FRA11B). The patient is the oldest reported with both imbalance of 4q+ and 11q-.

Adult↗

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Base Composition↗

Liver iron depletion and toxicity of the iron chelator deferiprone (L1, CP20) in the guinea pig.

The use of the iron chelator deferiprone (L1, CP20, 1,2-dimethyl-3-hydroxypyrid-4-one) for the treatment of diseases of iron overload and other disorders is problematic and requires further evaluation. In this study the efficacy, toxicity and mechanism of action of orally administered L1 were investigated in the guinea pig using the carbonyl iron model of iron overload. In an acute trial, depletion of liver non-heme iron in drug-treated guinea pigs (normal iron status) was maximal (approximately 50% of control) after a single oral dose of L1 of 200 mg kg-1, suggesting a limited chelatable pool in normal tissue. There was no apparent toxicity up to 600 mg kg-1. In each of two sub-acute trials, normal and iron-loaded animals were fed L1 (300 mg kg-1 day-1) or placebo for six days. Final mortalities were 12/20 (L1) and 0/20 (placebo). Symptoms included weakness, weight loss and eye discharge. Iron-loaded as well as normal guinea pigs were affected, indicating that at this drug level iron loading was not protective. In a chronic trial guinea pigs received L1 (50 mg kg-1 day-1) or placebo for six days per week over eight months. Liver non-heme iron was reduced in animals iron-loaded prior to the trial. The increase in a wave latency (electroretinogram), the foci of hepatic, myocardial and musculo-skeletal necrosis, and the decrease in white blood cells in the drug--treated/normal diet group even at the low dose of 50 mg kg-1 day-1 suggests that L1 may be unsuitable for the treatment of diseases which do not involve Fe overload. However, the low level of pathology in animals treated with iron prior to the trial suggests that even a small degree of iron overload (two-fold after eight months) is protective at this drug level. We conclude that the relationship between drug dose and iron status is critical in avoiding toxicity and must be monitored rigorously as cellular iron is depleted.

Administration, Oral↗

Localisation of a 10q breakpoint within the PAX2 gene in a patient with a de novo t(10;13) translocation and optic nerve coloboma-renal disease.

We describe a 5 year old boy with a de novo t(10;13) translocation and optic nerve coloboma-renal disease (ONCR). On the basis of GTG banding analysis of prometaphase chromosomes, the patient's karyotype was interpreted as either 46,XY,t(10;13)(q24.3;q12.3) or t(10;13) (q25.2;q14.1). Fluorescence in situ hybridisation (FISH) studies using a YAC clone containing the PAX2 gene and YAC clones adjoining FRA10B at 10q25.2 showed that the 10q breakpoint had occurred just within the PAX2 gene and was proximal to FRA10B. These FISH results suggest that the translocation causes a disruption of the PAX2 gene and leads to ONCR, in agreement with the recent reports of PAX2 mutations in two unrelated families with ONCR. Furthermore, we refined the regional mapping of the human PAX2 gene to the junction of bands 10q24.3 and 10q25.1.

Child, Preschool↗