PubMed Health⌕ Search

Biomedical subjects

E Earle

Publications and source records attributed to E Earle.

At least 19 recordsLinked to original sources
PubMed2001

Mosaic inv dup(8p) marker chromosome with stable neocentromere suggests neocentromerization is a post-zygotic event.

Marker chromosomes containing active human neocentromeres have been described in individuals where the chromosomes are non-mosaic, suggesting that they are mitotically stable, but also in individuals where there is mosaicism, raising the possibility of neocentromere instability. We report two independently ascertained individuals who are mosaic for a supernumerary marker chromosome, shown by reverse chromosome painting to have an 8p origin, resulting in mosaicism for tetrasomy 8p23.1-->pter in the patient. The markers have a primary constriction but show no detectable centromeric alpha-satellite DNA. The marker in Patient 1 demonstrated no centromere protein CENP-B binding, but associated with nine different functionally critical centromere proteins. Investigation of peripheral blood lymphocytes from this patient on five separate occasions over a 13-year period showed 23-46% mosaicism for the marker chromosome with no decrease in incidence. In vitro investigation of primary and secondary sub-clones of a lymphoblast cell line derived from the patient demonstrated 100% stability of the marker chromosome indicating that neocentromere instability is unlikely to be responsible for the mosaicism in the patient. This and other available data support a general model of neocentromerization as a post-zygotic event, irrespective of whether the supernumerary chromosome fragment has arisen during meiosis or post-fertilization at mitosis.

Adolescent↗
PubMed2001

A 330 kb CENP-A binding domain and altered replication timing at a human neocentromere.

Centromere protein A (CENP-A) is an essential centromere-specific histone H3 homologue. Using combined chromatin immunoprecipitation and DNA array analysis, we have defined a 330 kb CENP-A binding domain of a 10q25.3 neocentromere found on the human marker chromosome mardel(10). This domain is situated adjacent to the 80 kb region identified previously as the neocentromere site through lower-resolution immunofluorescence/FISH analysis of metaphase chromosomes. The 330 kb CENP-A binding domain shows a depletion of histone H3, providing evidence for the replacement of histone H3 by CENP-A within centromere-specific nucleosomes. The DNA within this domain has a high AT-content comparable to that of alpha-satellite, a high prevalence of LINEs and tandem repeats, and fewer SINEs and potential genes than the surrounding region. FISH analysis indicates that the normal 10q25.3 genomic region replicates around mid-S phase. Neocentromere formation is accompanied by a replication time lag around but not within the CENP-A binding region, with this lag being significantly more prominent to one side. The availability of fully sequenced genomic markers makes human neocentromeres a powerful model for dissecting the functional domains of complex higher eukaryotic centromeres.

Autoantigens↗
PubMed2000

Bub3 gene disruption in mice reveals essential mitotic spindle checkpoint function during early embryogenesis.

Bub3 is a conserved component of the mitotic spindle assembly complex. The protein is essential for early development in Bub3 gene-disrupted mice, evident from their failure to survive beyond day 6.5-7.5 postcoitus (pc). Bub3 null embryos appear normal up to day 3.5 pc but accumulate mitotic errors from days 4.5-6.5 pc in the form of micronuclei, chromatin bridging, lagging chromosomes, and irregular nuclear morphology. Null embryos treated with a spindle-depolymerising agent fail to arrest in metaphase and show an increase in mitotic disarray. The results confirm Bub3 as a component of the essential spindle checkpoint pathway that operates during early embryogenesis.

Animals↗
PubMed2000

VN training.

Explore the source record for details and available documents.

Animal Technicians↗
PubMed2000

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗
PubMed2000

Uterine dysfunction and genetic modifiers in centromere protein B-deficient mice.

Centromere protein B (CENP-B) binds constitutively to mammalian centromere repeat DNA and is highly conserved between humans and mouse. Cenpb null mice appear normal but have lower body and testis weights. We demonstrate here that testis-weight reduction is seen in male null mice generated on three different genetic backgrounds (denoted R1, W9.5, and C57), whereas body-weight reduction is dependent on the genetic background as well as the gender of the animals. In addition, Cenpb null females show 31%, 33%, and 44% reduced uterine weights on the R1, W9.5, and C57 backgrounds, respectively. Production of "revertant" mice lacking the targeted frameshift mutation but not the other components of the targeting construct corrected these differences, indicating that the observed phenotype is attributable to Cenpb gene disruption rather than a neighbouring gene effect induced by the targeting construct. The R1 and W9.5 Cenpb null females are reproductively competent but show age-dependent reproductive deterioration leading to a complete breakdown at or before 9 months of age. Reproductive dysfunction is much more severe in the C57 background as Cenpb null females are totally incompetent or are capable of producing no more than one litter. These results implicate a further genetic modifier effect on female reproductive performance. Histology of the uterus reveals normal myometrium and endometrium but grossly disrupted luminal and glandular epithelium. Tissue in situ hybridization demonstrates high Cenpb expression in the uterine epithelium of wild-type animals. This study details the first significant phenotype of Cenpb gene disruption and suggests an important role of Cenpb in uterine morphogenesis and function that may have direct implications for human reproductive pathology.

Animals↗
PubMed1999

Trisomy 20p resulting from inverted duplication and neocentromere formation.

Normal human centromeres contain large tandem arrays of alpha-satellite DNA of varying composition and complexity. However, a new class of mitotically stable marker chromosomes which contain neocentromeres formed from genomic regions previously devoid of centromere activity was described recently. These neocentromeres are fully functional yet lack the repeat sequences traditionally associated with normal centromere function. We report here a supernumerary marker chromosome derived from the short arm of chromosome 20 in a patient with manifestations of dup(20p) syndrome. Detailed cytogenetic, FISH, and polymorphic microsatellite analyses indicate the de novo formation of the marker chromosome during meiosis or early postzygotically, involving an initial chromosome breakage at 20p11.2, followed by an inverted duplication of the distal 20p segment due to rejoining of sister chromatids and the activation of a neocentromere within 20p12. This inv dup(20p) marker chromosome lacks detectable centromeric alpha-satellite and pericentric satellite III sequences, or centromere protein CENP-B. Functional activity of the neocentromere is evidenced by its association with 5 different, functionally critical centromere proteins: CENP-A, CENP-C, CENP-E, CENP-F, and INCENP. Formation of a neocentromere on human chromosome 20 has not been reported previously and in this context represents a new mechanism for the origin of dup(20p) syndrome.

Centromere↗
PubMed1999

Conservation of centromere protein in vertebrates.

The chicken genome comprises 78 chromosomes which include several macrochromosomes and many microchromosomes. Very little information is currently available concerning chicken centromere structure and function and it is unclear if the two types of chromosomes share a common centromere mechanism or whether this mechanism resembles those in other species. Immunofluorescence studies using antibodies to mammalian constitutive centromere proteins CENP-A, CENP-B, and CENP-C and the passenger proteins CENP-E, and CENP-F revealed the presence of each of these proteins at the centromeres of both macro- and microchromsomes. CENP-A, CENP-B, and CENP-E levels showed variability between metaphase centromeres while CENP-C and CENP-F levels were relatively constant. These results suggest a common centromere mechanism for both types of chromosomes as well as indicating a high degree of conservation of individual proteins between widely divergent vertebrate classes and an overall conservation of centromere function throughout vertebrate evolution.

Animals↗
PubMed1999

Defective chromosome segregation, microtubule bundling and nuclear bridging in inner centromere protein gene (Incenp)-disrupted mice.

INCENP is a chromosomal passenger protein which relocates from the centromere to thel spindle midzone during the metaphase-anaphase transition, ultimately being discarded in the cell midbody at the completion of cytokinesis. Using homologous recombination, we have generated Incenp gene-targeted heterozygous mice that are phenotypically indistinguishable from their wild-type littermates. Intercrossing the hetero-zygotes results in no live-born homozygous Incenp -disrupted progeny, indicating an early lethality. Day 3.5 affected pre-implantation embryos contain large, morphologically abnormal cells that fail to fully develop a blastocoel cavity or thrive in utero and in culture. Chromatin and tubulin immunocytochemical stainings of these and day 2.5 affected embryos reveal a high mitotic index, no discernible metaphase or anaphase stages, complete absence of midbodies, micronuclei formation, morphologically irregular macronuclei with large chromosome complements, multipolar mitotic configurations, binucleated cells, internuclear bridges and abnormal spindle bundling. The phenotype is consistent with a defect in the modulation of microtubule dynamics, severely affecting chromosome segregation and resulting in poorly resolved chromatin masses, aberrant karyokinesis and internuclear bridge formation. These latter occurrences could pose a physical barrier blocking cytokinesis.

Animals↗
PubMed1999

Neocentromere formation in a stable ring 1p32-p36.1 chromosome.

Neocentromeres are functional centromeres formed in chromosome regions outside the normal centromere domains and are found in an increasing number of mitotically stable human marker chromosomes in both neoplastic and non-neoplastic cells. We describe here the formation of a neocentromere in a previously undescribed chromosomal region at 1p32-->p36.1 in an oligospermic patient. Cytogenetic GTL banding analysis and the absence of detectable fluorescence in situ hybridisation (FISH) signals using telomeric probes indicate the marker to be a ring chromosome. The chromosome is negative for CBG banding and is devoid of detectable centromeric alpha satellite and its associated centromere protein CENP-B, suggesting activation of a neocentromere within the 1p32-36.1 region. Functional activity of the neocentromere is shown by the retention of the ring chromosome in 97% of the patient's lymphocytes and 100% of his cultured fibroblasts, as well as by the presence of key centromere binding proteins CENP-E, CENP-F, and INCENP. These results indicate that in addition to CENP-A, CENP-C, and CENP-E described in earlier studies, neocentromere activity can further be defined by CENP-F and INCENP binding. Our evidence suggests that neocentromere formation constitutes a viable mechanism for the mitotic stabilisation of acentric ring chromosomes.

Adult↗
PubMed1998

Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights.

CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.

Animals↗
PubMed1998

Targeted disruption of mouse centromere protein C gene leads to mitotic disarray and early embryo death.

Centromere protein C (CENPC) is a key protein that has been localized to the inner kinetochore plate of active mammalian centromeres. Using gene targeting techniques, we have disrupted the mouse Cenpc gene and shown that the gene is essential for normal mouse embryonic development. Heterozygous mice carrying one functional copy of the gene are healthy and fertile, whereas homozygous embryos fail to thrive. In these embryos, mitotic arrest and gross morphological degeneration become apparent as early as the morula stage of development. The degenerating embryos demonstrate highly irregular cell and nuclear morphologies, including the presence of a large number of micronuclei. Mitotic chromosomes of these embryos display a scattered and often highly condensed configuration and do not segregate in an ordered fashion. These results describing the phenotype of the mutant mouse embryos indicate that CENPC has a direct role in the mitotic progression from metaphase to anaphase.

Animals↗
PubMed1997

A functional neo-centromere formed through activation of a latent human centromere and consisting of non-alpha-satellite DNA.

We recently described a human marker chromosome containing a functional neo-centromere that binds anti-centromere antibodies, but is devoid of centromeric alpha-satellite repeats and derived from a hitherto non-centromeric region of chromosome 10q25. Chromosome walking using cloned single-copy DNA from this region enabled us to identify the antibody-binding domain of this centromere. Extensive restriction mapping indicates that this domain has an identical genomic organization to the corresponding normal chromosomal region, suggesting a mechanism for the origin of this centromere through the activation of a latent centromere that exists within 10q25.

Binding Sites, Antibody↗
PubMed1993

A chromosome 13-specific human satellite I DNA subfamily with minor presence on chromosome 21: further studies on Robertsonian translocations.

We describe a new human satellite I DNA subfamily (pTRI-6) which is composed of 72 copies of monomeric repeating units of 42 basepairs (bp). These repeating units are tandemly organized into a higher order structure of 2.97 kilobases (kb). Sequencing of this DNA revealed base substitutions, deletions and insertions, and an overall conservation of 85% among the monomers. The sequence has a high AT content of 77%. Under low-stringency in situ hybridization conditions, satellite I is found on the pericentric regions of chromosomes 3 and 4 and on all the acrocentric chromosomes. On the acrocentric chromosomes, satellite I is further detected on the distal p13 region. Analysis of somatic cell hybrids under high stringency indicates the presence of the pTRI-6 subfamily predominantly on chromosome 13. Chromosome 21 shows a 50- to 100-fold reduced amount of this subfamily and the presence of other sequences closely related to pTRI-6. Investigation of a group of 11 human t(14q21q) Robertsonian translocations revealed the retention of satellite I DNA around the breakpoints in all cases. These results extend our understanding of these translocations and of the general structural organization of the cen-pter regions of the acrocentric chromosomes.

Base Sequence↗
PubMed1992

Absence of satellite III DNA in the centromere and the proximal long-arm region of human chromosome 14: analysis of a 14p- variant.

Cytogenetic methods and molecular probes derived from the centromere and short arm of chromosome 14 were used to investigate the structural properties of a chromosome 14 variant. Results of GTL, CBG, Ag-NOR, and non-banded Giemsa staining of the chromosomes suggested the complete absence of the short arm and possibly a large part of the centromere. Negative in situ hybridisation with an alpha satellite III probe confirmed the absence of the arm; the detection of normal amounts of alpha satellite DNA, however, indicated retention of the centromeric domain. The natural occurrence of a human acrocentric variant lacking a short arm was thus established. Within the detection limits of the methods used, the results demonstrate that satellite III DNA is not essential for normal centromeric activity and allow us to exclude the presence of this satellite DNA within the centromere and proximal long-arm region of human chromosome 14.

Centromere↗