PubMed Health⌕ Search

Biomedical subjects

E I Budovskiĭ

Publications and source records attributed to E I Budovskiĭ.

At least 19 recordsLinked to original sources
PubMed1986

[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene].

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.

Base Sequence↗
PubMed1986

[Tritium labeling of RNA and protein of bacteriophage MS2].

Thermal activation of tritium gas is used for labeling of the nucleoprotein, phage MS 2. The obtained preparation of tritiated phage has a specific radioactivity of 20-50 Ci/mmole, is considerably infectious and appears suitable for a wide range of studies. The radioactivity is distributed between intraphage RNA and phage outer protein (approximately 1:3 ratio). Consequently, phage capsid is porous and sufficiently permeable for activated tritium atoms.

Coliphages↗
PubMed1985

[Changes in subunit conformation and their reciprocal configuration in the transition from the pretranslocated to the posttranslocated state].

RNA-protein contacts in pretranslocated and posttranslocated states of E. coli ribosomes have been determined by means of UV-induced cross-linking. In the two functional states as well as in free 70C ribosome, the same proteins are involved in RNA-protein intersubunit contacts, located in the region of L1 protuberance (left side of 70S ribosome). The transition from pre- to posttranslocated state is accompanied by disappearance of RNA-protein contacts in the region of L7/L12 stalk. This favours the locking-unlocking model of the translating ribosome.

Escherichia coli↗
PubMed1985

[General method of isolation and analysis of polynucleotide fragments cross-linked with proteins].

A fragment of 16S RNA, cross-linked to S7 protein by UV irradiation of the 30S subunit of E. coli ribosome, was obtained by the action of T1 ribonuclease on the irradiated nucleoprotein. The digest was treated with polynucleotide kinase in the presence of [gamma-32P]ATP and the S7-cross-linked oligonucleotides were isolated. An individual oligonucleotide attached to S7 protein was obtained after proteinase treatment of the respective spot followed by electrophoresis. Sequencing of this oligonucleotide established its structure as 1233-1240 fragment of 16S RNA, the U1239 residue being the site of the S7 cross-linking. The developed general approach can be used for localizing protein - cross-linked residues in polynucleotides, whatever is the procedure employed for cross-linking.

Base Sequence↗
PubMed1984

[Effect of O-hydroxylamine on the transforming DNA from Bacillus subtilis. Correlation of chemical modifications with genetic consequences].

The action of methoxyamine (MA) on B. subtilis transforming DNA (50 degrees C, pH 4,5 and 6,0, 1 M MA) was studied. The rate of cytosine residues modification in DNA is 250 times less than in monomer (rate constants for DNA are 1,5 X 10(-1) min-1 at pH 4,5, and 2,5 X 10(-6) min-1 in the first 300 hours of treatment at pH 6,0). At pH 4,5 the rates of cytosine (I) conversion into N4-methoxycytosine (II) and into 6-methoxyamino-5,6-dihydro-N4-methoxycytosine (III) are constant (II/III ratio is about 2,1). At pH 6,0 the II/III ratio smoothly increases from 1,0 to 1,6 (200 and 900 hours of treatment) due to a decrease in the product III accumulation rate. The frequency of MA-induced mutations shows a bell-shaped dependence on time with maxima (approximately 10%) at 80 (pH 4,5) and 500 (pH 6,0) hours of treatment. In both cases approximately 10% of cytosine residues are modified. These results suggest that either compound III is efficiently removed from the transforming DNA, or its presence does not arrest the DNA replication.

Bacillus subtilis↗
PubMed1983

[Mutagenic action of O-methlhydroxylamide on transforming DNA].

The mutagenic effect of O-methylhydroxylamine (OMHA) on transforming DNA of Bacillus subtilis was studied. In accordance with the earlier reported chemical and functional data, the mutagenic effect was observed at 4.5 and 6.0 pH. An increase in pH caused a decrease in the rate of mutagenesis, though the maximal level of mutagenesis was equal at both values of pH. The results obtained with recipients defective in the system of UV-repair revealed that both products of reaction of OMHA with the cytosine-base of DNA, N4-metoxycytidine and N4-metoxy-6-metoxyamino-5,6-dihydrocytidine, are effectively eliminated through the system of UV repair.

Bacillus subtilis↗
PubMed1978

[Induction of direct mutations of intracellular phage cd exposed to O-methylhydroxylamine].

Intracellular development of DNA-containing cd phage in the presence of O-methylhydroxylamine (in vivo mutagenesis) results in 50-fold increase of mutants in the phage progeny. The main effect is due to the mutagen presence during replication of phage DNA (within 10-20 min after the infection). The presence of the mutagen both before and after DNA replication does not produce any considerable mutagenic effect. Comparison of the data obtained with kinetic reaction of O-methylhydroxylamine with nucleic acid components is due to enzymatic formation of modified precursors, N4-metoxycytidine and/or N6-metoxyadenosine derivatives, which have dual functional specificity, and to their incorporation into genome under DNA replication. The presence of O-methylhydroxylamine increases not only the number of mixed clones with a high content of mutants, but also the number of pure mutant clones. Recombinogenic activity of O-methylhydroxylamine is considered to be a possible cause of this effect.

Cell Division↗
PubMed1975

[Role of cytosine photohydrates in the UV-induced mutagenesis of phage Sd].

Substitution of H2O for D2O does not affect the rate of UV-inactivation of the extracellular phage Sd, containing double-stranded DNA. However, the yield of plaque-mutants induced by UV-irradiation in D2O is significantly lower, that in H2O. This difference is mostly pronounced at doses greater than 100 erg/mm2. Since the substitution of H2O for D2O selectively decelerate photohydration of pyrimidines (only cytosines in DNA), one could conclude that the formation of cytosine photohydrates in DNA accounts for significant part of UV-induced mutations but it is not an essential reason for UV-inactivation of extracellular phage Sd.

Coliphages↗
PubMedDate not supplied

[Proteins contacting with peptidyl-tRNA at the A-site of the Escherichia coli ribosome after enzymatic and non-enzymatic binding of aminoacyl-tRNA].

Proteins contacting (directly interacting) with peptidyl-tRNA in the A-site of E. coli ribosome were determined by means of ultraviolet-induced RNA-protein cross-linking. It has been shown that upon enzymatic binding of Phe-tRNAPhe with the posttranslocated ribosome and following transpeptidation, the peptidyl-tRNAPhe directly interacts with proteins S5, S10, L6, L16 and S13/S14/L27, while upon non-enzymatic binding--with S5, S10, L2, L6 and L16. These data evidenced, that the difference in tRNA-protein interactions upon enzymatic and non-enzymatic binding of Phe-tRNAPhe to the ribosome does not prevent the following step and remains after transpeptidation.

Escherichia coli↗
PubMedDate not supplied

[Principles of selective inactivation of the virus genome. IV. The effect of UV-irradiation of phage MS2 on its binding with anti-MS2-immunoglobulins].

Ultraviolet (254 nm) irradiation of the bacteriophage MS2 results in the decrease of the number of antigenic determinants exposed on the virion surface. The cross-section of the decrease, as measured by the number of anti-MS2 IgG molecules bound per virion, is 10(-16) mm2 per photon. The decrease of the phage-antibody binding proceeds after irradiation with a rate constant of about 5 x 10(-3) min-1. Since the antigenic determinants of the phage MS2 coat protein does not contain photoreactive amino acid residues, the irradiation-induced decrease of the phage antibody binding is determined, most probably, by the shielding of the antigenic determinants. Such shielding could be caused by rearrangement of coat protein molecules and/or of the capsid induced by photomodification of non-antigenic fragments of coat protein and/or of intraphage RNA.

Animals↗
PubMedDate not supplied

[Contacts of ribosomal proteins with tRNAPhe and 16S RNA in analogs of the 30S initiation complex].

Direct RNA-protein contacts have been studied by means of ultraviolet-induced (254 nm) cross-links inside complexes of NAcPhe-tRNAPhe, Phe-tRNAPhe and deacylated tRNAPhe with poly(U)-charged 30S subunit of Escherichia coli ribosome. In the first two complexes tRNA directly contacts with the similar sets of proteins (S4, S5, S7, S9/S11; S6 and S8 are found only in the second complex). These sets are similar to that in the fMet-tRNAfMet X 30S X mRNA complex, evidencing similar disposition of tRNAs in these three complexes. 16S RNA contacts in free 30S subunit mainly with proteins S4, S7 and S9/S11. In both complexes, containing NAcPhe-tRNAPhe and Phe-tRNAPhe, 16S RNA contacts with essentially the same proteins (S4, S5, S7, S8, S9/S11, S10, S15, S16 and S17) and in the same ratio, evidencing similar conformation of 30S subunit in these two complexes. In the third complex deacylated tRNAPhe contacts with proteins S4, S5, S6, S8, S9/S11 and S15, 16S RNA-protein interaction differs from those in the first two complexes by a remarkable decrease of cross-linked proteins S8, and S9/S11 and by the appearance of a large amount of cross-linked proteins(s) S13/S14. Hence, this complex differs from the first two by conformation of 30S subunit and, probably, by disposition and/or conformation of tRNA.

Bacterial Proteins↗
PubMedDate not supplied

[Ribosomal proteins interacting with Phe-tRNAPhe during enzymatic binding with translating ribosome before and after the release of the elongation factor EF-Tu].

Proteins, directly interacting with tRNA in R- and A-sites of E. coli ribosome were determined by means of ultraviolet-induced RNA-protein cross-links. It is shown, that tRNAPhe in the R-site (upon enzymatic binding of the ternary complex Phe-tRNAPhe. X Tu X GMPPCP to ribosome) directly interact with factor Tu and ribosomal proteins S4, S5, S8 and L6, while in the A-site (upon binding of Phe-tRNAPhe X Tu X GTP, GTP hydrolysis, Tu release and transpeptidation)--with proteins S5, S10, L6, L16 and S13/S14/L27.

Escherichia coli↗