Biomedical subjects

E S Collie

Publications and source records attributed to E S Collie.

3 recordsLinked to original sources

PubMed1993

PilS and PilR, a two-component transcriptional regulatory system controlling expression of type 4 fimbriae in Pseudomonas aeruginosa.

Transposon mutagenesis was used to identify genes necessary for the expression of Pseudomonas aeruginosa type 4 fimbriae. In a library of 12,700 mutants, 147 were observed to have lost the spreading colony morphology associated with the presence of functional fimbriae. Of these, 28 had also acquired resistance to the fimbrial-specific bacteriophage PO4. The mutations conferring this phage resistance were found to have occurred at at least six different loci, including the three that had been previously shown to be required for fimbrial biosynthesis or function: the structural subunit (pilA) and adjacent genes (pilB,C,D), the twitching motility gene (pilT), and the sigma 54 RNA polymerase initiation factor gene (rpoN). One novel group of phage-resistant mutants was identified in which the transposon had inserted near sequences that cross-hybridized to an oligonucleotide probe designed against conserved domains in regulators of RpoN-dependent promoters. These mutants had no detectable transcription of pilA and did not produce fimbriae. A probe derived from inverse polymerase chain reaction was used to isolate the corresponding wild-type sequences from a P. aeruginosa PAO cosmid reference library, and two adjacent genes affected by transposon insertions, pilS and pilR, were located and sequenced. These genes were shown to be capable of complementing the corresponding mutants, both at the level of restoring the phenotypes associated with functional fimbriae and by the restoration of pilA transcription. The pilSR operon was physically mapped to Spel fragment 5 (corresponding to about 72-75/0 min on the genetic map), and shown to be located approximately 25 kb from pilA-D. PilS and PilR clearly belong to the family of two-component transcriptional regulatory systems which have been described in many bacterial species. PilS is predicted to be a sensor protein which when stimulated by the appropriate environmental signals activates PilR through kinase activity. PilR then activates transcription of pilA, probably by interacting with RNA polymerase containing RpoN. The identification of pilS and pilR makes possible a more thorough examination of the signal transduction systems controlling expression of virulence factors in P. aeruginosa.

Amino Acid Sequence↗

PubMed1992

The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.

Actins↗

PubMed1992

Tissue-specific expression of the skeletal alpha-actin gene involves sequences that can function independently of MyoD and Id.

The skeletal alpha-actin gene is a member of the sarcomeric contractile protein gene family and is specifically expressed in differentiated muscle. The skeletal alpha-actin gene is regulated efficiently by enhancer and regulatory sequences between nucleotide positions -1282 and -87. In the present study we have shown that the sequences 3' of nucleotide position -87 can functionally interact with the SV40 enhancer in a tissue-specific manner and can restrict the ubiquitous function of the SV40 enhancer to myogenic cells. Site-specific cassette mutagenesis was used to delimit the sequences upstream of the TATA motif (-32), between nucleotide positions -64 and -37, that mediate efficient expression in myogenic cells in the presence of the SV40 enhancer. The skeletal alpha-actin promoter was trans-activated by the helix-loop-helix (HLH) transcription factors MyoD, MRF-4, and Myogenin, in pluripotential 10T1/2 fibroblasts and trans-repressed by the HLH protein Id (inhibitor of differentiation) in myogenic C2C12 cells. This trans-regulation required sequences upstream of -87 and occurred independently of the two consensus E boxes (CANNTG) at positions +18 and +71. The -64/-37 region interacted with purified Sp1 and an unidentified protein(s), proximal regulatory factor(s) I (PRF-I). We conclude that the muscle-specific expression of the skeletal alpha-actin promoter is not simply determined by MyoD elements and enhancer and regulatory sequences, but that the minimal promoter contains important determinants of cell-specific transcription that can function independently of the helix-loop-helix transcription factors.

Actins↗