A method of cloning multiple direct repeats of a DNA segment.
Explore the source record for details and available documents.
Base Sequence↗
Biomedical subjects
E S Hwang
Publications and source records attributed to E S Hwang.
Targeted cleavage of mRNA by human RNase P.
Ribonuclease P from Escherichia coli can cleave RNAs in simple, hydrogen-bonded complexes of two oligoribonucleotides that resemble the aminoacyl stem and 5' leader sequence of tRNA precursors. RNase P from human (HeLa) cells cannot catalyze the cleavage in vitro of the 5'-proximal oligoribonucleotide that contains the leader sequence in such simple complexes but can do so when the 3'-proximal oligoribonucleotide (external guide sequence) is altered to resemble three-quarters of a tRNA molecule. In such a complex, the efficiency of cleavage of the mRNA for chloramphenicol acetyltransferase, as the 5'-proximal oligoribonucleotide, depends on the structural details of the external guide sequence and on the choice of target site within the mRNA. The presence of the appropriately designed external guide sequence in cells in tissue culture reduces chloramphenicol acetyltransferase activity and the level of the corresponding intact mRNA in the cells. Thus, it appears that the use of such external guide sequences may provide a general technique for gene inactivation.
Base Sequence↗
Distribution of the SGLT1 Na+/glucose cotransporter and mRNA along the crypt-villus axis of rabbit small intestine.
The expression of the Na+/glucose cotransporter (SGLT1) mRNA and protein along the crypt-villus axis of the rabbit small intestine was examined using in situ hybridization and immunocytochemical techniques. We detected mRNA in the cells on the villus, but not in the crypts, and the mRNA abundance increased 6-fold from the base to the tip of the villus. SGLT1 protein was restricted to the brush borders of mature enterocytes. We suggest that the high rate of sugar transport across the tips of the villus is due to the transcription of the SGLT1 gene in mature enterocytes, the subsequent translation of SGLT mRNA, and the insertion direct of the functional SGLT1 transporter into the brush border membrane of these cells lining the villus tip.
Animals↗
Interaction of integration host factor from Escherichia coli with the integration region of the Haemophilus influenzae bacteriophage HP1.
The specific DNA-binding protein integration host factor (IHF) of Escherichia coli stimulates the site-specific recombination reaction between the attP site of bacteriophage HP1 and the attB site of its host, Haemophilus influenzae, in vitro and also appears to regulate the expression of HP1 integrase. IHF interacts specifically with DNA segments containing the att sites and the integrase regulatory region, as judged by IHF-dependent retardation of relevant DNA fragments during gel electrophoresis. The locations of the protein-binding sites were identified by DNase I protection experiments. Three sites in the HP1 attP region bound IHF, two binding sites were present in the vicinity of the attB region, and one region containing three partially overlapping sites was present in the HP1 integrase regulatory segment. The binding sites defined in these experiments all contained sequences which matched the consensus IHF binding sequences first identified in the lambda attP region. An activity which stimulated the HP1 site-specific integration reaction was found in extracts of H. influenzae, suggesting that an IHF-like protein is present in this organism.
Bacterial Proteins↗
Characterization of a Na+/glucose cotransporter cloned from rabbit small intestine.
The Na+/glucose cotransporter from rabbit intestinal brush border membranes has been cloned, sequenced, and expressed in Xenopus oocytes. Injection of cloned RNA into oocytes increased Na+/sugar cotransport by three orders of magnitude. In this study, we have compared and contrasted the transport properties of this cloned protein expressed in Xenopus oocytes with the native transporter present in rabbit intestinal brush borders. Initial rates of 14C-alpha-methyl-D-glucopyranoside uptake into brush border membrane vesicles and Xenopus oocytes were measured as a function of the external sodium, sugar, and phlorizin concentrations. Sugar uptake into oocytes and brush borders was Na+-dependent (Hill coefficient 1.5 and 1.7), phlorizin inhibitable (Ki 6 and 9 microM), and saturable (alpha-methyl-D-glucopyranoside Km 110 and 570 microM). The sugar specificity was examined by competition experiments, and in both cases the selectivity was D-glucose greater than alpha-methyl-D-glucopyranoside greater than D-galactose greater than 3-O-methyl-D-glucoside. In view of the close similarity between the properties of the cloned protein expressed in oocytes and the native brush border transporter, we conclude that we have cloned the classical Na+/glucose cotransporter.
Animals↗
Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.
A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.
Antigens, Viral↗
Factors responsible for in vitro transformation of Inaba and Hikojima from Ogawa type El Tor vibrio.
Explore the source record for details and available documents.
Animals↗
Leiomyosarcoma in childhood and adolescence.
BACKGROUND: Few series of leiomyosarcoma in patients < 21 years of age have been reported. We reviewed our institutional experience with this neoplasm to learn disease characteristics, patterns of relapse, and outcome. METHODS: The records of 21 patients with leiomyosarcoma admitted to our institution were reviewed retrospectively; 18 of these were diagnosed after 1970. Overall survival was estimated using the Kaplan-Meier method. RESULTS: Ninety-five percent (20 of 21) were initially treated with a wide local excision that was complete with a negative microscopic margin in 10 (48%). There also was a strong correlation between grade and surgical margins. High-grade tumors were associated with a lower rate of complete resection. The majority underwent additional therapy. Radiation was used to treat both initial and recurrent disease in nine patients, with four of these undergoing brachytherapy. Thirteen patients were treated with adjuvant chemotherapy, most commonly doxorubicin (seven patients) and cisplatin (six patients). The median length of survival was 9.3 years, and there were nine disease-related deaths (43%). Of interest was the progressive decrease in survival with time. The 5-year overall survival rate was 79%; the 10-year rate was 49%. Three patients died of progressive disease > 10 years after initial diagnosis. CONCLUSIONS: We conclude that leiomyosarcomas arising in childhood and adolescence are associated with a good initial chance of survival that decreases progressively over time. Known prognostic factors from larger adult series are consistent with the present data, but they are not provable because of the small number of patients. In particular, the grade was correlated with surgical margins.
Adolescent↗
Intraperitoneal gene therapy with adenoviral-mediated p53 tumor suppressor gene for ovarian cancer model in nude mouse.
In an effort to develop a method for better local control of advanced ovarian cancers, we have established a peritoneal tumor model of ovarian cancer in the nude mouse and applied intraperitoneal gene therapy with the recombinant adenoviral-mediated wild-type p53 tumor suppressor gene (Avp53). The results indicate that: (a) the recombinant adenoviral vector system effectively infected the tumor and normal cells in the peritoneal cavity; and (b) Avp53 treatment effectively suppressed the growth of peritoneal tumors and prolonged the survival of the treated group, especially when the tumor burden was less. These results suggest that intraperitoneal gene therapy using Avp53 is potentially useful as an adjuvant therapeutic modality in human ovarian cancer.
Adenoviridae↗
Early characteristic findings in bowleg deformities: evaluation using magnetic resonance imaging.
We used magnetic resonance imaging (MRI) to evaluate bowleg deformities in infancy. Twenty-five tibiae of 13 infants were examined and divided into two groups based on MRI findings: group A had high intensity area in the medial epiphyseal cartilage on T2-weighted images. Group B had depression of medial physis and abnormal signal in the perichondrial region in addition to the epiphyseal lesion. At the final follow-up, all cases in group A demonstrated normal lower leg alignments, whereas five cases in group B showed characteristic roentogenographic findings of Blount's disease. The improvement rate of metaphyseal-diaphyseal angle was correlated with this classification. These findings suggested that abnormal findings in physis and perichondrial region might be preliminary findings in early stage of Blount's disease. The high intensity areas in the medial epiphyseal cartilage were commonly found among the cases with bowing deformities, which suggested that there might be a common pathomechanism between physiologic bowing and infantile Blount's disease.
Age Factors↗