PubMed Health⌕ Search

Biomedical subjects

Eugene K W Sim

Publications and source records attributed to Eugene K W Sim.

At least 19 recordsLinked to original sources
PubMed2006

Angiopoietin-1 for myocardial angiogenesis: a comparison between delivery strategies.

UNLABELLED: We compare the effectiveness of direct adenoviral angiopoietin-1 (Ad-Ang-1) injection with transplantation of skeletal myoblasts (SkMs) over-expressing angiopoietin-1 (Ang-1) for angiogenic response and improvement of heart function in an experimental porcine model of myocardial infarction (MI). METHODS: Ad-Ang-1 was used for intramyocardial injection or transduction of SkMs. Three weeks after coronary artery ligation in 32 female pigs, animals were grouped to receive multiple intramyocardial injections of DMEM without cells (group-1; n=7), or containing 3 x 10(8)Lac-z labelled SkMs transduced with Ad-Null vector carrying no gene (group-2; n=7), or 1 x 10(10) PFU Ad-Ang-1 (group-3; n=9), or 3 x 10(8)Lac-z labelled SkMs transduced with Ad-Ang-1 (group-4; n=9). The animals were immunosuppressed for 6-weeks. After euthanasia, their heart tissue was processed for histological studies. RESULTS: Extensive survival of Lac-z positive SkMs was observed in and around the infarct 6 and 12-weeks after transplantation. Fluorescent immunostaining for vWF-VIII at 6-weeks revealed increased blood vessel density (x100) in group-4 (p<0.05) as compared with other groups. Regional blood flow (ml/g/min) in the peri-infarct area was improved in group-4 (2.7; p<0.05) as compared with group-1 (1.2+/-0.1), group-2 (1.1+/-0.4) and group-3 (1.7+/-0.1) at 6-weeks. Similarly, ejection fraction was significantly higher in group-4 (49.2+/-5.9%, p=0.03) as compared with group-1 (36.8+/-3%) at 6 weeks. CONCLUSION: SkMs mediated Ang-1 delivery is associated with improved angiogenic response, regional myocardial perfusion and heart function as compared with direct Ad-Ang-1 administration.

Actins↗
PubMed2006

Improved angiogenic response in pig heart following ischaemic injury using human skeletal myoblast simultaneously expressing VEGF165 and angiopoietin-1.

OBJECTIVE: To achieve angiogenic interaction between VEGF(165) and angiopoietin-1 (Ang-1) using a novel adenoviral bicistronic vector (Ad-Bic) encoding the two factors and delivered ex vivo using sex-mismatched human skeletal myoblasts. METHODS AND RESULTS: A myocardial infarction model was developed in 29 female pigs; randomised into four groups: DMEM (group-1, n=6); Adenovirus null (Ad-null) vector-myoblast (group-2, n=5); Ad-Ang-1 myoblast (group 3, n=7) and Ad-Bic-myoblast (group-4, n=11). Three weeks later, 5 ml DMEM without myoblasts or containing 3 x 10(8) myoblasts carrying lac-z gene and transduced with Ad-null, Ad-Ang-1 or Ad-Bic were injected intra-myocardially in and around the infarct. 2D-echocardiography and fluorescent microsphere studies 6- and 12-weeks post-treatment revealed significantly improved cardiac performance and regional blood flow in groups 3 and 4. Histological studies and Y-chromosome analysis revealed extensive survival of lac-z positive myoblasts staining positive for human proteins in the pig heart. ELISA, immunostaining and RT-PCR revealed that Ad-Bic transduced myoblasts concomitantly but transiently expressed hVEGF(165) and Ang-1 both in vitro and in vivo. Double fluorescent immunostaining of the tissue sections for vWFactor-III and smooth muscle actin showed significantly higher vascular density of mature blood vessels per low power microscopic field in groups 3 and 4 at 6- and 12-weeks. CONCLUSION: Our combined approach led to enhanced angiogenesis with a greater percentage of functionally mature blood vessels in a porcine heart.

Adenoviridae↗
PubMed2006

Angiopoietin-1 promotes functional neovascularization that relieves ischemia by improving regional reperfusion in a swine chronic myocardial ischemia model.

This study investigates the long-term angiogenic effects of ANG-1 and VEGF in a swine chronic myocardial ischemia model. Four-weeks after gradual occlusion of the left circumflex coronary artery by ameroid constrictor, animals were injected with recombinant adenoviral vectors carrying either human ANG-1 (n=9), human VEGF(165) (n=10) or empty vector (n=7) into the left ventricle free wall supplied by the constricted artery. Left ventricular perfusion in animals that received AdANG-1 (3.25+/-0.16 ml/min/g, p<0.05) recovered robustly 4 weeks after gene transfer while ischemia persisted in the AdVEGF (1.09+/-0.13 ml/min/g) and empty vector (1.20+/-0.03 ml/min/g) groups. Microvascular densities in the left ventricles of animals that received AdANG-1 (19.61+/-1.76/0.572 mm(2) myocardial tissue, p<0.05) and AdVEGF (18.17+/-1.43/0.572 mm(2) myocardial tissue, p<0.05) were significantly higher than animals that received empty vector (13.53+/-0.92/0.572 mm(2) myocardial tissue) 12 weeks after gene transfer. ANG-1, but not VEGF, contributed to enhanced regional perfusion by increasing arteriolar density (1.9+/-0.4/0.572 mm(2) myocardial tissue vs. 0.7+/-0.2/0.572 mm(2) myocardial tissue, p<0.05) of large-sized (50-100 microm) arterioles. These data demonstrate that gene transfer of ANG-1 and VEGF enhances angiogenesis, but ANG-1 promotes sustained improvement of ventricular perfusion that expedites recovery of ischemic myocardium via arteriogenesis.

Adenoviridae↗
PubMed2006

Cardioprotective effect of des-Aspartate-angiotensin-I (DAA-I) on cytokine gene expression profile in ligation model of myocardial infarction.

We investigate the influence of des-Aspartate-angiotensin-I (DAA-I) on the cytokine expression profile in a rodent model of myocardial infarction. Myocardial infarction model was created in female Wistar rats by coronary artery ligation. Animals were randomized to receive intravenously either a daily dose of 1.2 mug DAA-I/kg body weight (group 1; n = 60) or saline (group 2; n = 60) for 14 days after infarction. Heart function was assessed by echocardiography. Animals were euthanized at 1, 3, 7, 14 and 31 days. Morphometric analysis using tetrazolium chloride staining revealed that infarct size was reduced by 32.2% (p < 0.05) in group 1 after 14 days of DAA-I treatment. Left ventricular ejection fraction in group 1 improved significantly (73.4%) as compared to group 2 (47.7%; p < 0.001). Immunostaining for immune cells at the infarct site showed that CD8+ lymphocytes infiltration at the infarct site declined in group 1 (15 +/- 5 cells) as compared to group 2 (50 +/- 6 cells; p < 0.001). Infiltration of monocytes and macrophages remained high at day 14 in group 2 (126 +/- 40 cells) as compared to group 1 (49 +/- 11 cells; p = 0.006). Multiplex PCR was done for differential gene expression of various pro-inflammatory cytokines. IL-6, TNF-alpha, TGF-beta and GM-CSF expression were significantly down-regulated in the infarct, peri-infarct and contra-lateral zones of the left ventricle in group 1 as compared to group 2. IL-6, TGF-beta and GM-CSF expression started to decline from day 1 of DAA-I treatment while TNF-alpha expression only reduced after 7 days of DAA-I treatment. We conclude that DAA-I prevented infarct expansion through suppression of inflammatory cytokines and immune cell infiltration in the infarct region.

Angiotensin I↗
PubMed2006

Adult stem cells for cardiac repair: a choice between skeletal myoblasts and bone marrow stem cells.

The real promise of a stem cell-based approach for cardiac regeneration and repair lies in the promotion of myogenesis and angiogenesis at the site of the cell graft to achieve both structural and functional benefits. Despite all of the progress and promise in this field, many unanswered questions remain; the answers to these questions will provide the much-needed breakthrough to harness the real benefits of cell therapy for the heart in the clinical perspective. One of the major issues is the choice of donor cell type for transplantation. Multiple cell types with varying potentials have been assessed for their ability to repopulate the infarcted myocardium; however, only the adult stem cells, that is, skeletal myoblasts (SkM) and bone marrow-derived stem cells (BMC), have been translated from the laboratory bench to clinical use. Which of these two cell types will provide the best option for clinical application in heart cell therapy remains arguable. With results pouring in from the long-term follow-ups of previously conducted phase I clinical studies, and with the onset of phase II clinical trials involving larger population of patients, transplantation of stem cells as a sole therapy without an adjunct conventional revascularization procedure will provide a deeper insight into the effectiveness of this approach. The present article discusses the pros and cons of using SkM and BMC individually or in combination for cardiac repair, and critically analyzes the progress made with each cell type.

Adult↗
PubMed2005

Reversal of myocardial injury using genetically modulated human skeletal myoblasts in a rodent cryoinjured heart model.

BACKGROUND: We hypothesized that combination therapy using human myoblasts and VEGF165 will lead to better prognosis in a failing heart. METHODS: Forty-eight female Wistar rats with cryoinjured hearts were randomized into non-treated normal (group-1, n=12), DMEM injected (group-2, n=10), myoblast-transplanted (group-3, n=12) and myoblast-hVEGF(165) (group-4, n=14). Ten days after cryoinjury, 200 microl DMEM containing 3x10(6) cells or without cells was injected into the injured myocardium. Animals were maintained on cyclosporine for 6 weeks post cell transplantation. Heart function was assessed by echocardiography. Animals were sacrificed and hearts were processed for histochemical and immunohistochemical studies. RESULTS: Histological examination showed survival of the donor myoblasts expressing lac-z and hVEGF165 in rat cardiac tissue. Fluorescent immunostaining for vWillebrand Factor-VIII and smooth muscle actin expression at low power microscope (x100) showed significantly higher blood vessel density in group-4 (31.25+/-1.82; 24.63+/-0.92) as compared to group-2 (13.29+/-1.0; p<0.001; 9.71+/-0.81, p<0.001) and group-3 (16.50+/-1.43, p<0.001; 14.5+/-1.34, p<0.001). Echocardiography showed that ejection fraction and fractional shortening of group-3 (93.36+/-1.52%, p=0.005; 75+/-3.75%, p=0.024) and group-4 (94.8+/-1.62%, p=0.003; 76.13+/-2.15%, p=0.011) significantly improved as compared to group-2 (81.8+/-3.3%, 55.1+/-7.18%). CONCLUSION: Myoblasts carrying of hVEGF165 are potential therapeutic transgene carriers for cardiac repair.

Analysis of Variance↗
PubMed2005

Transit-time flow measurement is essential in coronary artery bypass grafting.

BACKGROUND: Patent bypass grafts are fundamental to successful coronary artery bypass grafting. Intraoperative flow measurement through newly constructed grafts is a test of patency. We studied the use of transit-time flow measurement to determine its ability to detect technical errors in grafts, to measure the mean flow norms for Asian patients, and to compare arterial and vein grafts. METHODS: From January 1, 2001, to June 30, 2002, 116 patients underwent isolated primary coronary artery bypass grafting. Sixty-seven patients underwent conventional coronary artery bypass grafting and 49 patients underwent off-pump coronary artery bypass grafting. There were 125 arterial and 197 vein grafts. Transit-time flow measurement was carried out on all completed grafts. Graft patency was assessed using flow curves, mean flow, and pulsatility index. Average of mean flows was calculated to determine mean flow norms. Arterial and vein grafts were compared by statistical analysis between the variables mean flow and pulsatility index. RESULTS: In 6 patients with seven grafts, intraoperative graft assessment detected technical errors, which were corrected. Average mean flow was 37.4 +/- 23.5 mL/min for left anterior descending coronary artery-to-left internal mammary artery grafts, and values ranging from 21.2 to 36.0 mL/min for the rest. There were no statistically significant differences in mean flow or pulsatility index between arterial and vein grafts. CONCLUSIONS: Transit-time flow measurement enables technical problems to be diagnosed accurately, allowing prompt revision of grafts. It should be mandatory in coronary artery bypass grafting to improve surgical outcomes.

Blood Flow Velocity↗
PubMed2005

In vitro functional assessment of human skeletal myoblasts after transduction with adenoviral bicistronic vector carrying human VEGF165 and angiopoietin-1.

OBJECTIVES: We report in vitro functional assessment of human skeletal myoblasts with adenoviral bicistronic vector carrying human vascular endothelial growth factor-165 (hVEGF165) and angiopoietin-1 (Ang-1). METHODS: Myoblasts were assessed for their purity by desmin expression. A replication incompetent adenoviral bicistronic vector (Ad-Bic) carrying both hVEGF165 and Ang-1 was used for transduction of myoblasts. Transduction efficiency was assessed by dual fluorescent immunostaining of the transduced myoblasts. Expression efficiency was analyzed by enzyme linked immunosorbent assay (ELISA), Western blot and reverse transcription polymerase chain reaction (RT-PCR). The biological activity of the secreted human VEGF165 and Ang-1 was determined by human umbilical vein endothelial cells (HUVEC) proliferation assay, Thymidine [H3] incorporation assay and capillary-like structure formation. RESULTS: The myoblasts preparation was >98% pure. Fluorescent immunostaining showed >95% transduction efficiency. The transduced myoblasts secreted VEGF(165) for up to 30 days after transduction, with peak level (32 +/- 4 ng/ml) at day 8 after transduction as revealed by VEGF ELISA. Western blot further confirmed that both angiogenic factors were actively secreted by transduced myoblasts. The molecular weight was 42 kD for hVEGF165 and 70 kD for Ang-1 respectively. The expression of hVEGF165 and Ang-1 was significantly reduced at day-30 after transduction as seen by RT-PCR. The conditioned medium from bicistronic vector transduced myoblasts stimulated HUVEC to proliferate much faster than other conditioned media (>1.5 folds). Thymidine incorporation assay further confirmed this finding. Matrigel experiment suggested that HUVEC under the condition of both growth factors formed significantly more capillary-like structure. CONCLUSIONS: The bicistronic vector transduced myoblasts provides a novel strategy for therapeutic angiomyogenesis for cardiac repair.

Adenoviridae↗
PubMed2004

Angiomyogenesis for cardiac repair using human myoblasts as carriers of human vascular endothelial growth factor.

This study investigated the potential of human skeletal myoblast carrying human VEGF(165) for angiomyogenesis for cardiac repair. A porcine heart model of chronic infarction was created in 18 female swine by coronary artery ligation. The animals were randomized into: group 1, DMEM injected ( n=6), group 2, myoblast transplanted ( n=5) and group 3, VEGF(165) myoblast transplanted ( n=7). Three weeks later 5 ml DMEM containing 3x10(8) myoblast carrying exogenous genes were injected into 20 sites in left ventricle intramyocardially in groups 2 and 3. Group 1 animals were injected 5 ml DMEM without cells. Animals were kept on 5 mg/kg cyclosporine per day for 6 weeks. Regional blood flow was measured using fluorescent microspheres. The heart was explanted between 6-12 weeks after transplantation for histological studies. Histological examination showed survival of lac-z expressing myoblasts in host tissue. Capillary density at low power field (x100) was 57.13+/-4.20 in group 3 which was significantly higher than the other groups. Regional blood flow was significantly improved 6 and 12 weeks after transplantation, which was 2.41+/-0.11 and 3.39+/-0.11 ml(-1) min(-1) g(-1), respectively, in group 3. Left ventricular ejection fraction increased from 31.25+/-4.09% to 43.0+/-2.68% at 6 weeks in group 3. Human myoblasts are potential transgene carriers for the myocardium, in addition to strengthening the weakened myocardium through myogenesis.

Actins↗
PubMed2004

Autologous skeletal myoblasts transduced with a new adenoviral bicistronic vector for treatment of hind limb ischemia.

OBJECTIVE: We aimed to achieve angiogenic synergism between human vascular endothelial growth factor 165 (VEGF 165 ) and angiopoietin-1 (Ang-1) using a new adenoviral bicistronic vector concurrently with cell therapy to repair an ischemically damaged hind limb in a rabbit model. METHODS: Rabbit autologous primary skeletal myoblasts were isolated and labeled with retrovirally transduced LacZreporter gene, 4,6-diamidino-2-phenylindole (DAPI), and 5-bromo-2'-deoxyuridine (BrdU). Hind limb ischemia was created in 48 female New Zealand White rabbits by means of femoral artery ligation at 8 different places, and was assessed at angiography. Animals were randomized to receive intramuscular injection of either Dulbeco's Modified Eagle Medium (DMEM;group 1, n = 8), nontransduced myoblasts (group 2, n = 10), or myoblasts transduced with Ad-Null (group 3, n = 10), Ad-VEGF (group 4, n = 10), or Ad-Bicis (group 5, n = 8). Six weeks after treatment neovascularization in the limb was assessed at angiography. The animals were euthanized, and tissue was harvested for histologic study. RESULTS: Extensive transplanted myoblast survival was observed in all cell-transplanted groups, as visualized with DAPI, BrdU, and LacZ staining. Angiographic blood vessel count revealed enhanced neovascularization in group 5 (25.14 +/- 5.14) compared with group 4 (13.62 +/- 4.52), group 3 (6.09 +/- 0.09), group 2 (4.67 +/- 3.49), and group 1 (3.18 +/- 7.76). Immunostaining for von Willebrand factor confirmed significantly increased capillary density ( P < .01) at high-power microscopic field in group 5 (19.04 +/- 1.59) compared with group 4 (15.31 +/- 1.55), group 3 (6.53 +/- 0.97), group 2 (5.69 +/- 0.51), and group 1 (3.03 +/- 0.20). CONCLUSION: Simultaneous expression of VEGF and Ang-1 from bicistronic vector transduced skeletal myoblasts potently stimulated enhanced functional neovascularization in a rabbit model of limb ischemia.

Adenoviridae↗
PubMed2004

Myoblast transplantation for cardiac repair: a clinical perspective.

The incidence of heart failure is achieving epidemic proportions. Adult human myocytes cannot regenerate because these cells do not re-enter the cell cycle. In patients with heart failure, myoblast transplantation is emerging as a potential therapeutic option to augment the function of remaining myocytes. Both skeletal myoblasts and autologous bone marrow cell transplantation, after intensive preclinical experimental animal studies, have entered phase I safety studies in humans. Most of these clinical trials have involved small groups of patients and cell transplantation was carried out as an adjunct to coronary revascularization. Preliminary results show that the procedure is safe and leads to improved myocardial function. This paper reviews and summarizes the outcome of these phase I trials involving skeletal myoblast transplantation.

Animals↗
PubMed2004

Therapeutic angiogenesis for treatment of peripheral vascular disease.

Peripheral vascular disease (PVD) is characterized by compromised circulation to the limbs. Currently, PVD is treated conservatively and the first-line options include therapy with pain medication and "anti-thrombotic" drugs to prevent blood from clotting. Nonsurgical interventions such as angioplasty and thrombolytic therapy provide alternative treatment modalities. However, in the case of severe symptoms and with progressive deterioration, surgical interventions such as bypass surgery, atherectomy and even amputation may be necessary. Despite major advances in these areas, PVD is challenging, and difficult to manage with the current surgical and conservative medical approaches. In some cases, even short-term results in treated patients with advanced stage disease remain unsatisfactory. Indeed, there is a great clinical need for new treatment options that may stimulate collateral blood vessel growth, increase vascularity and improve skeletal muscle function.

Animals↗
PubMed2004

Therapeutic angiogenesis using vascular endothelial growth factor.

Therapeutic angiogenesis using vascular endothelial growth factor can reduce tissue ischemia by simulating the natural process of angiogenesis. Vascular endothelial growth factor not only stimulates endothelial cells to proliferate and migrate, but also mobilizes endothelial progenitor cells and achieves vascular protection. Besides direct administration of angiogenic proteins, plasmids and viral vectors carrying angiogenic genes have been used. Animal experiments have shown promise with evidence of neovascularization and improved perfusion in the target myocardium. Initial phase I and II clinical trials results are encouraging and reflect the potential success of therapeutic angiogenesis as a clinical modality for the treatment of ischemic heart disease. This review discusses the role of vascular endothelial growth factor in therapeutic angiogenesis, along with the problems and considerations of this approach as a treatment strategy.

Angiogenesis Inducing Agents↗
PubMed2003

High efficiency transduction of human VEGF165 into human skeletal myoblasts: in vitro studies.

We report the transduction of human VEGF165 gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF165 was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF165 specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF165 was determined by human umbilical vein endothelial cell proliferation and [H3] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165) positive myoblasts. Western blotting and ELISA revealed high VEGF165 expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF165 released in the culture medium peaked (37 +/- 3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF165 transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF165 antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300 +/- 50 pg/ml) that is enhanced many folds (37 +/- 3 ng/ml) in VEGF165 transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF165 to achieve concurrent angiomyogenesis for cardiac repair.

Adenoviridae↗