PubMed Health⌕ Search

Biomedical subjects

F Huang

Publications and source records attributed to F Huang.

At least 127 records · Page 7Linked to original sources

5'-RNA self-capping from guanosine diphosphate.

A selected RNA (isolate 6) efficiently catalyzes a self-capping reaction with free GDP, yielding the same 5'-capped structure as is formed by protein GTP:RNA guanylyltransferase. This unexplored RNA-catalyzed reaction type involving nucleophilic attack on phosphate by phosphate adds to the variety of possible postsynthetic RNA-catalyzed RNA modifications. The selected RNA requires only Ca2+ for activation and has a broad active pH range of 4.5-9.0. The RNA also has a 5'-pyrophosphatase activity.

Base Sequence↗

Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region.

We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.

Animals↗

Inhibition of Toosendanin on the delayed rectifier potassium current in neuroblastoma x glioma NG108-15 cells.

The effect of Toosendanin (TSN), a presynaptic transmission blocker, on the outward delayed rectifier potassium current (IKD) of NG108-15 cells was studied by using the whole-cell voltage-clamp technique. It was observed that externally applying TSN not only reduced IKD amplitude in a dose-dependent and partial reversible manner but also accelerated its inactivation. The effect of internally applying TSN was also examined by including TSN in the electrode, and it was the same as that of externally applying TSN. Further, comparison observations with TEA, 4-AP, verapamil, nifedipine, and (+/-)-Bay K 8644 were also made, and the results were as follows. The time courses of TSN's inhibition effect as well as its recovery after washing were much slower than those of TEA and 4-AP. Externally applying TEA or 4-AP reduced IKD amplitude but did not accelerate its inactivation. Externally applying verapamil, nifedipine, or (+/-)-Bay K 8644, however, similarly to the effect of TSN, not only reduced IKD amplitude but also accelerated its inactivation. Thus, from the obtained results it is suggested that TSN might diffuse into the cell interior and act intracellularly, and the underlying mechanism might be different from that of TEA and 4-AP but similar to that of verapamil, nifedipine, and (+/-)-Bay K 8644 to some extent.

3-Pyridinecarboxylic acid, 1,4-dihydro-2,6-dimethy↗

Induction of alternative splicing of HLA-B27 by bacterial invasion.

OBJECTIVE: Alternative splicing of certain class I major histocompatibility complex pre-messenger RNA (pre-mRNA) is known to lead to generation of a cell-free soluble protein analog. This study was undertaken to examine whether this process occurs with HLA-B27, whether the process is modified by arthritis-causing bacteria, and whether the assembly of the soluble molecules follows the same pathway as the integral parent molecules. METHODS: Alternative splicing of pre-mRNA was analyzed by reverse transcriptase-polymerase chain reaction, and assembly of soluble HLA-B27 by immunoprecipitation followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. RESULTS: There was alternative splicing of the pre-mRNA of HLA-B27. The process could be amplified by invasion with Salmonella or Yersinia bacteria. The soluble HLA-B27 was assembled in a pathway similar to that of the parent molecule. CONCLUSION: The association between arthritis-causing bacteria and HLA-B27 positive cells is a complex event. Soluble HLA-B27 is a potential key player.

Alternative Splicing↗

Conformational studies of dithymidine boranomonophosphate diastereoisomers.

The boranophosphate ester nucleotides are a new class of nucleic acid analogues that are isoelectronic and isostructural to normal phosphodiester nucleic acids and that maintain the anionic charge of the nucleic acid backbone. The two P-diastereoisomers of dithymidine boranomonophosphates were separated using reverse phase HPLC; the faster and slower eluting isomers are designated as d(TpBT)-1 and d(TpBT)-2, respectively. Conformations of the isomers were studied using-circular dichroism (CD) and NMR, and compared to the analogous phosphate diester, d(TpT). This comparison allowed the effects of the borane group and chirality of the boranophosphate linkage on sugar and base conformations to be assessed. The CD spectra of the diastereoisomers are consistent with both having a B-type conformation. Analysis of the 1H-1H and 1H-31P coupling constants showed that these conformations are similar to those of the unmodified parent dimer; specifically, the 2'-deoxyribose rings prefer the S (C2'-endo) conformation, and the C4'-C5' and C5'-O5' rotamers are primarily in the gamma + and beta + conformations, respectively. Conformational differences between the diastereoisomers and between the modified and unmodified dimers are manifested by differences in the preferences of the 3'-residues to adopt S sugar pucker and beta + conformations. There is reduced preference for the S sugar pucker of the 3'-residue in d(TpBT)-1 relative to d(TpBT)-2, which is similar to d(TpT). There is less preference for the beta + conformation of the 3'-residue in d(TpBT)-2 relative to d(TpBT)-1 and d(TpT). Based on the CD results, the temperature dependences of the thymidine H6 chemical shifts, and the derived sugar ring and backbone conformational parameters, we conclude that the borane group exerts a minimal influence on the sugar conformations and base stacking interactions. Preliminary assignment of the absolute configuration of the pair of SP and RP diastereoisomers to d(TpBT)-1 and d(TpBT)-2, respectively, is made on the basis of enzyme selectivity and NOE difference experiments.

Boron↗

Characterization of 5'-proximal sequence of mouse GABA transporter gene (GAT-1).

The cDNA molecule encoding the mouse GABA transporter gene (GAT-1) was used as probe for selecting GAT-1 gene from mouse genomic library. A positive clone, harboring the whole open reading frame of the GAT-1 protein and designated as MGABAT-G, was fished out from the library, the 5' proximal region and intron 1 were sequenced and analysed, and low homology was found in the above region between GAT-1 genes from mouse and human except some short conserved sequences. The DNA-protein interactions between DNA fragments containing the conserved sequences in the 5' proximal region and nuclear proteins from different tissues of mouse were studied by means of gel-shift assay, and Southern-Western blot. The results indicate a possible positive-negative regulation mode controlling the expression of the mouse GAT-1 gene.

Animals↗

[Primary study of bacterial adhesion of prosthetic valve materials].

The adhesion of Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Pseudomonas aeruginosa and Candida albicans to Dacron and pyrolite carbon was measured in vitro with plate counting. The experimental result showed: the bacterials used in the experiment have adhesion to prosthetic valve materials; the bacterials have stronger adhesion to Dacron than to Pyrolite carbon; the bacterial adhesive capacity is significantly different and is affected by mechanical and chemical nature of biomaterials; Staphylococcur aureus has the strongest adhesion to Dacron, and Pseudomonas aeruginosa has the strongest adhesion to pyrolite carbon in all bacterials.

Bacterial Adhesion↗

[Studies on the analgesic and antiinflammatory action of radix Linderae extract].

Both of aqueous extract and alconol extract of Radix Linderae at a dose 5 g/kg and 10 g/kg could length obviously pain threshold in mice in hot plate test. The samples at a dose 20 g/kg could inhibit significantly the writhing frequency induced by potassium antimony tartate in mice, also antagonize the swelling of ear induced by inflammatory agent and decrease the swelling rate. The component further isolated from the plant could antagonize the swelling of rat toes induced by carrageenin.

Analgesics↗

[Implantation of allogenic osteoblast combined with calcium phosphate composites].

The aim of this experiment was to study the osteogenesis in vivo of allogenic osteoblast combined culture with calcium phosphate composites. The osteoblasts were obtained by enzymatic digestion of periosteum from fibula subcultured to 13 generations, the cells were combined culture with hydroxyapatite and biphasic calcium phosphate. Subseguently, the composite was implanted into rabbits subcutaneously or intramuscularly. The blank material was implanted in the contralateral side as control. Four weeks later, all animals were sacrificed. All the implants were examined by gross observation, histological examination and EDXA. The results showed: 1. obvious ingrowth of connective tissue with very little inflammatory reaction; 2. new bone formation in the composites with deposit of Ca and P on the surface of osteoblast, but none in the blank materials; 3. no significant difference of new bone formation between the different sites of implantation or different materials, but those implanted intramuscularly had lamellae form of new bone while those implanted subcutaneously had only mineralization of extracellular matrix. The conclusion were: 1. the composites are biocompatible with prior osteogenesis property; 2. periosteal-derived allogenic osteoblasts obatined by enzymatic digestion could survive following implantation with bioactivity; 3. rich blood supply might be advantageous to new bone formation and its maturation.

Animals↗

[Repair of long segment bone defect of femur by free juxtaposed bilateral fibulae autograft].

There were several methods, such as free single and folded fibulae autograft, composed tissue autograft, however, it is still very difficult to repair long segment bone defect. In December 1995, we used free juxtaposed bilateral fibulae autograft to repair an 8 cm of femoral bone defect in a 4 years old child in success. The key procedure is to strip a portion of the neighboring periosteal sleeve of juxtaposed fibulae to make bare of the opposite sides of the bone shafts, suture the opposite periosteal sleeves, keep the nutrient arteries, and reconstruct the blood circulation of both fibular by anastomosis of the distal ends of one fibular artery and vein to the proximal ends of the other fibular artery and vein, and anastomosis of the proximal ends of the fibular artery and vein to lateral circumflex artery and vein. After 22 months follow up, the two shafts of juxtaposed fibulae fused into one new bone shaft. The diameter of the new bone shaft was nearly the same as the diameter of the femur. There was only one medullary cavity, and it connected to the medullary cavity of femur. This method also cold be used to repair other long segment bone defect.

Anastomosis, Surgical↗

[Color Doppler flow imaging study on the changes of collateral circulation between portal-superior vena cava and azygos vein before and after endoscopic ligation of the esophageal varix].

Color Doppler flow imaging (CDFI) was performed in 35 patients with portal hypertension and esophageal varix. Thirty subjects were served as control. After esophageal variceal ligation, CDFI observed that the portal-superior vena cava collateral veins were partialy blocked. The esophageal varices disappeared. The esophageal wall thinned. Diameter of left gastric vein enlarged and blood flow velocity decreased. Azygos diameter was reduced and blood flow velocity was decreased. Although diameter of portal vein was not changed, the blood flow velocity slightly increased. The results suggest that ligation treatment can have the tendency to increase blood flow of liver and stomach, which might aggravate gastric mucosal lesion.

Adolescent↗

Membrane permeabilization induced by cytolytic delta-endotoxin CytA from Bacillus thuringiensis var. israelensis.

CytA is a member of a functionally defined family of insecticidal delta-endotoxins occurring in parasporal crystals of Bacillus thuringiensis var. israelensis. We investigated the ability of CytA to permeabilize the membrane and release fluorescence marker molecules from unilamellar lipid vesicles. Both protoxin (27 kDa) and proteolytically activated toxin (24 kDa) were very effective in permeabilization of unilamellar lipid vesicles: concentrations as low as several nanomolar produced a significant effect. The toxin was about 2-3 times more effective than the protoxin. The concentration of CytA required for the same extent of calcein release in large unilamellar vesicles (LUV) was 5-10 times lower than that in small unilamellar vesicles (SUV). Both small (calcein) and large (fluorescein-dextrans, MW 3000 and 10 000) molecules were released from the vesicles by CytA with comparable single-exponential kinetics. The release was an all-or-none event, i.e., each vesicle either released all of its contents or remained completely intact. Binding of CytA to lipid membranes did not show appreciable cooperativity, the apparent binding constant (Kapp) being on the order of 10(5) M-1. The plots of kinetics of release vs bound protein/ lipid ratio and the differential effects of CytA on LUV vs SUV indicate that at least 140 toxin molecules or 311 protoxin molecules must bind to an LUV before the latter starts losing its integrity. The necessity of adsorption of this relatively large number of toxin molecules to trigger permeabilization, together with the lack of discrimination in the size of the released marker molecules, suggests that the effect of CytA is a general, detergent-like, perturbation of the membrane rather than creation of small, well-defined, proteinaceous channels.

Bacillus thuringiensis↗

Assessment of chromatographic peak purity by means of artificial neural networks.

An improved chemometric approach is proposed for assessing chromatographic peak purity by means of artificial neural networks. A non-linear transformation function with a back-propagation algorithm was used to describe and predict the chromatographic data. The Mann-Whitney U-test was used for the concluding the purity of the chromatographic peak. Simulation data and practical analytical data for both pure and mixture samples were analysed with satisfactory results. A prior knowledge of the impurity and the related compound is unnecessary when a slight difference between their chromatogram and spectrum exists. The performance on simulated data sets by this approach was compared with the results from principal component analysis.

Algorithms↗

Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alpha1-syntrophin mediated by PDZ domains.

Neuronal nitric oxide synthase (nNOS) is concentrated at synaptic junctions in brain and motor endplates in skeletal muscle. Here, we show that the N-terminus of nNOS, which contains a PDZ protein motif, interacts with similar motifs in postsynaptic density-95 protein (PSD-95) and a related novel protein, PSD-93.nNOS and PSD-95 are coexpressed in numerous neuronal populations, and a PSD-95/nNOS complex occurs in cerebellum. PDZ domain interactions also mediate binding of nNOS to skeletal muscle syntrophin, a dystrophin-associated protein. nNOS isoforms lacking a PDZ domain, identified in nNOSdelta/delta mutant mice, do not associate with PSD-95 in brain or with skeletal muscle sarcolemma. Interaction of PDZ-containing domains therefore mediates synaptic association of nNOS and may play a more general role in formation of macromolecular signaling complexes.

Amino Acid Sequence↗

A patient-derived cytotoxic T-lymphocyte clone and two peptide-dependent monoclonal antibodies recognize HLA-B27-peptide complexes with low stringency for peptide sequences.

HLA-B27 molecules expressed on the T2 mutant cell line do not have peptides. Such empty HLA-B27 molecules were not recognized by an HLA-B27-restricted cytotoxic T-lymphocyte (CTL) clone (auto-1) derived from synovial fluid. To test for peptide dependency of the clone, B27-T2 cells were incubated with a panel of 48 different peptides. This lack of stringency was compared with that of a peptide-dependent monoclonal antibody, B27.M2. Positive B27.M2 reactivity resulted when the B27-T2 cells were incubated with two peptides: RRKAMFEDI and RRMGPPVGHR, derived from Chlamydia HSP60 and human ribonucleoprotein, respectively. Because of the limited availability of CTL versus monoclonal antibody, the specificity of B27.M2 was studied in greater detail. The importance of the HLA-B27 heavy chain in antibody recognition of class I-peptide complexes was demonstrated by site-directed mutagenesis. The stringency of the peptide residues was tested by making analogs of each of the nine residues in RRKAMFEDI, creating a panel of 180 analogs. Although stringency was highest for the sixth position, as many as six different amino acids provided positive reactivity. These results indicate that immune recognition of HLA-B27-peptide complexes might have rather low stringency for the peptide sequences. In theory, then, pathogen-derived peptides which induce autoimmunity by generating autoreactive CTL might not share much sequence similarity with the responsible self peptides.

Amino Acid Sequence↗

Searching eye movement, smooth pursuit eye movement and schizophrenia.

OBJECTIVE: To detect whether the smooth pursuit eye movement (SPEM) and searching eye movement (SEM) could be considered as a biological marker of schizophrenia, and used as a tool in helping diagnosis of schizophrenia. METHODS: 88 schizophrenics, 77 patients with mood disorders, 32 with "neurosis", and 74 normal healthy controls were examined for SPEM and SEM individually. The authors verified the results in all the first-visit 150 outpatients in March 1993 by comparing the examination results with the clinical diagnoses after a 6-month follow-up. RESULTS: Significant differences were found in the number of eye fixation (NEF) and total eye scanning length (TESL) of SEM between schizophrenics and normal controls or patients with other disorders. Less NEF and shorter TESL could be helpful in differential diagnosis, and the agreement rate, Kappa coefficient was 0.62. No significant differences were found in SPEM in this investigation between non-medicated schizophrenics and normal controls. CONCLUSION: Searching eye movement (SEM) might be considered as a biological marker of schizophrenia and might be used as a supplementary tool in its diagnosis.

Adult↗