PubMed Health⌕ Search

Biomedical subjects

F L Kiechle

Publications and source records attributed to F L Kiechle.

At least 19 recordsLinked to original sources
PubMed2003

Insulin increases the intracellular concentration of total oxalyl thiolesters in BC3H-1 myocytes: potential anti-insulin mediators.

Oxalyl thiolesters (RS-CO-COOH) may represent negative intracellular messengers for insulin action. Using a reverse-phase, ion-pair high pressure liquid chromatographic technique, total intracellular oxalyl thiolesters were measured in insulin-sensitive BC3H-1 myocytes after the addition of insulin. The total oxalyl thiolester concentration increased to a maximum of 2.9 times the basal concentration by 30 min after the addition of 100 microU/ml insulin and decreased to 1.8 times by 180 min. Insulin's stimulation of pyruvate dehydrogenase as measured by lactate oxidation ([1-14C]-lactate --> 14CO2) in intact BC3H-1 myocytes reached a maximum at 15-30 min and returned to basal activity during the 60-90 min measurement interval. These results suggest that oxalyl thiolesters are increased in concentration following insulin-induced signal transduction to reverse insulin-stimulated metabolic events.

Animals↗
PubMed2001

Disruption of replication protein A/single-stranded DNA complexes during apoptosis in HL-60 cells.

Replication protein A (RPA) is a single-stranded DNA-binding protein which plays a role in DNA replication, repair, and recombination. We used gel mobility shift, super gel mobility shift, and Western blot to determine the fate of RPA during Hoechst 33342-induced apoptosis in HL-60 cells. Multiple bands were detected by gel mobility shift after the incubation of single-stranded gamma-(32)P-labeled oligo(dT)(30) with the nuclear extracts of HL-60 cells. Super gel mobility shift results indicated that only the highest molecular weight protein/oligo(dT)(30) complexes bound with anti-human RPA-32 and/or anti-human RPA-70 antibodies forming RPA/oligo(dT)(30) complexes. After the treatment of HL-60 cells with 15 microg/ml Hoechst 33342 for 3 h, the bands of RPA/oligo(dT)(30) complexes were decreased and bands of the lowest molecular weight protein/oligo(dT)(30) complexes were significantly increased when compared to the control group. These low-molecular-weight bands did not bind with RPA-32 or RPA-70 antibodies. Western blotting results showed that both RPA-32 and RPA-70 were decreased significantly in a time-dependent manner after 1 h of incubation with Hoechst 33342. These results demonstrate that in HL-60 cells, Hoechst 33342-induced apoptosis is associated with a rapid loss of the binding capacity of RPA to oligo(dT)(30) as well as immunoactive RPA-70 and RPA-32.

Apoptosis↗
PubMed2001

DNA technology, the clinical laboratory, and the future.

OBJECTIVE: To review the advances in clinically useful molecular biological techniques and their applications in clinical practice as presented at the Ninth Annual William Beaumont Hospital DNA Symposium. DATA SOURCES: The 10 manuscripts submitted were reviewed and their major findings were compared with literature on the same topic. STUDY SELECTION: One manuscript reviewed the development of pharmacogenetics, 3 described analytic approaches to detect aneuploidy or cancer, 1 described transcription factor E2F-1 increase during apoptosis, 2 reported on genetic and pharmacologic factors that influence platelet aggregation, 2 described molecular methods for detecting long QT syndrome or mycobacteria, and 1 reported a modification in collection of buccal DNA. DATA SYNTHESIS: Genomic and proteomic approaches to develop clinically useful assays have been successful. Aneuploidy can be easily detected by comparative genomic hybridization, which does not require cell culture like cytogenetics. Mutations have been characterized for a variety of hereditary cancer syndromes, 2 inherited long QT syndromes, and thromboembolism. PlA1 and PlA2 polymorphisms in platelets are associated with a difference in aggregation inhibition by estrogen, another example of genotypic pharmacogenetics. Protein expression differences may define colorectal cancer stage and explain apoptotic signal transduction. Mycobacterial detection by nucleic acid amplification and simplified buccal DNA collection demonstrate cost-effective strategies. CONCLUSION: The working draft of the Human Genome Project is completed and the number of clinically useful molecular pathologic techniques and assays will expand as additional disease-associated mutations are defined. Expanded use of database software for genomic and proteomic screening should increase the efficiency of clinical useful assay development.

Biotechnology↗
PubMed2001

Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells.

CONTEXT: Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions. OBJECTIVE: To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis. METHODS: The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. RESULTS: Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines. CONCLUSION: Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.

Animals↗
PubMed2001

Provider-performed microscopy.

The category of provider-performed microscopy was defined in the Federal Register to provide a unique regulatory approach for bright-field and phase-contrast microscopy performed by a physician, dentist, or midlevel practitioner examining labile specimens. A CLIA certificate for this category of testing is available, which also permits the performance of waived tests. Because these provider-performed microscopy procedures do not have quality-control materials available, special challenges are encountered in establishing and monitoring such testing within a hospital. Vigilance is required to maintain a provider-performed microscopy program within a hospital.

Adult↗
PubMed1999

DNA technology in the clinical laboratory.

OBJECTIVES: To review the advances in clinically useful molecular biological techniques and to identify their applications in clinical practice, as presented at the Eighth Annual William Beaumont Hospital Symposium. DATA SOURCES: The 10 manuscripts submitted were reviewed, and their major findings were compared with literature on the same topic. STUDY SELECTION: Two manuscripts addressed specimen (nucleic acid) stability, 2 described novel analytic approaches, 3 discussed detection of B- or T-cell clonality in lymphoproliferative disorders, and 3 reported the frequency of a variety of genetic polymorphisms found in cardiac disorders. DATA SYNTHESIS: DNA from dried blood spots is stable and may be purified rapidly for amplification and mutation analysis. RNA is much less stable, and a variety of methods may be used to reduce ribonuclease degradation of enteroviral RNA. False-negative reactions may be reduced by genomic amplification of ligated padlock probes by cascade rolling circle or polymerase chain reaction. A multiplex polymerase chain method using fluorescence-labeled products that separate both the wild-type and mutant hemochromatosis gene alleles by capillary gel electrophoresis represents another approach for detecting the 2 major missense mutations (C282Y and H63D) in hemochromatosis. Southern blotting and polymerase chain reaction have been used to detect B- and T-cell clonality in lymphoproliferative diseases, including mantle cell lymphoma and lymphoma of the breast. Genetic polymorphisms in a variety of coagulation factors and platelet glycoprotein IIIa are associated with ischemic heart disease. CONCLUSIONS: As the Human Genome Project continues to define disease-associated mutations, the number of clinically useful molecular pathologic techniques and assays will expand. Clinical outcome analysis is still required to document a decrease in the patient's length of stay to offset the cost of introducing molecular biological assays in the routine clinical pathology laboratory.

Clinical Laboratory Techniques↗
PubMed1998

Hoechst 33342 induces apoptosis and alters tata box binding protein/DNA complexes in nuclei from BC3H-1 myocytes.

Hoechst 33342 and Hoechst 33258 bind to adenine-thymine rich regions of the minor groove of DNA. Hoechst 33342, but not Hoechst 33258, induces BC3H-1 myocyte cell death and DNA fragmentation into an internucleosomal pattern characteristics of apoptosis. Hoechst 33342 has been shown to inhibit endogenous nuclear topoisomerase I activity. Another enzymatic activity utilizing the minor groove of DNA, the initiation of RNA polymerase II activity by formation of a TATA box binding protein/TATA box promoter complex, is shown to be altered using a gel mobility shift assay. A [32P]-labeled 24-oligonucleotide containing a TATA box element formed one molecular weight complex in control and Hoechst 33258 treated cells. The presence of Hoechst 33342 (26.7 microM) decreased the amount of the control complex and increased the presence of lower molecular weight species suggesting degradation of nuclear TBP and/or release of other transcription factors from the complex creating a smaller sized molecular complex which retains TATA box binding capacity. These results suggest that the pathway utilized to induce apoptosis in BC3H-1 myocytes may also involve the alteration of normal TBP/DNA complex formation and reduction in the initiation of new transcription.

Animals↗
PubMed1998

Multicenter study of oxygen-insensitive handheld glucose point-of-care testing in critical care/hospital/ambulatory patients in the United States and Canada.

OBJECTIVES: Existing handheld glucose meters are glucose oxidase (GO)-based. Oxygen side reactions can introduce oxygen dependency, increase potential error, and limit clinical use. Our primary objectives were to: a) introduce a new glucose dehydrogenase (GD)-based electrochemical biosensor for point-of-care testing; b) determine the oxygen-sensitivity of GO- and GD-based electrochemical biosensor test strips; and c) evaluate the clinical performance of the new GD-based glucose meter system in critical care/hospital/ambulatory patients. DESIGN: Multicenter study sites compared glucose levels determined with GD-based biosensors to glucose levels determined in whole blood with a perchloric acid deproteinization hexokinase reference method. One site also studied GO-based biosensors and venous plasma glucose measured with a chemistry analyzer. Biosensor test strips were used with a handheld glucose monitoring system. Bench and clinical oxygen sensitivity, hematocrit effect, and precision were evaluated. SETTING: The study was performed at eight U.S. medical centers and one Canadian medical center. PATIENTS: There were 1,248 patients. RESULTS: The GO-based biosensor was oxygen-sensitive. The new GD-based biosensor was oxygen-insensitive. GD-based biosensor performance was acceptable: 2,104 (96.1%) of 2,189 glucose meter measurements were within +/-15 mg/dL (+/-0.83 mmol/L) for glucose levels of < or = 100 mg/dL (< or = 5.55 mmol/L) or within +/-15% for glucose levels of > 100 mg/dL, compared with the whole-blood reference method results. With the GD-based biosensor, the percentages of glucose measurements that were not within the error tolerance were comparable for different specimen types and clinical groups. Bracket predictive values were acceptable for glucose levels used in therapeutic management. CONCLUSIONS: The performance of GD-based, oxygen-insensitive, handheld glucose testing was technically suitable for arterial specimens in critical care patients, cord blood and heelstick specimens in neonates, and capillary and venous specimens in other patients. Multicenter findings benchmark the performance of bedside glucose testing devices. With the new +/-15 mg/dL --> 100 mg/dL --> +/-15% accuracy criterion, point-of-care systems for handheld glucose testing should score 95% (or better), as compared with the recommended reference method. Physiologic changes, preanalytical factors, confounding variables, and treatment goals must be taken into consideration when interpreting glucose results, especially in critically ill patients, for whom arterial blood glucose measurements will reflect systemic glucose levels.

Adult↗
PubMed1996

Counter modulation of adipocyte mitochondrial processes by insulin and S-oxalylglutathione.

Oxalyl thiolesters, a group of putative intracellular regulators, have been shown to be in vitro inhibitors of some cytosolic enzymes which are stimulated by insulin. In this study, the effects of insulin and oxalyl thiolesters on pyruvate dehydrogenase, beta-oxidation, and acyl-CoA hydrolase activities in mitochondria from rat epididymal adipocytes are compared. Using glutathione, CoASH, cysteine, and cysteamine as thiol sources, oxalyl thioesters were synthesized, purified, and quantitated. Mitochondria were isolated from rat epididymal adipocytes, some of which were incubated with or without insulin. Mitochondrial activities were determined by radioisotopic assay subsequent to control, insulin, or oxalyl thiolester incubation. Under the conditions used in this study, pyruvate dehydrogenase activity was increased 28% subsequent to 10-min incubation of adipocytes with 400 microU/ml insulin; in contrast, preincubation of adipocyte mitochondria with S-oxalylglutathione resulted in a dose-dependent 11-19% inhibition of pyruvate dehydrogenase. S-oxalylglutathione also attenuated the spermine-induced activation of pyruvate dehydrogenase. Insulin treatment resulted in a small but significant increase in beta-oxidation of palmitic acid while 100 microM S-oxalylglutathione mediated a 40% decrease in palmitate oxidation. Palmitoyl-CoA hydrolase activity was decreased 14% by insulin treatment; however, S-oxalylglutathione caused a 14-50% increase in hydrolase activity. The other oxalyl thiolesters were not as effective or as consistent as S-oxalylglutathione in modulation of the mitochondrial activities; free thiols and oxalic acid did not modulate the activities. In summary, pyruvate dehydrogenase, palmitate beta-oxidation, and palmitoyl-CoA hydrolase activities in adipocyte mitochondria were modulated in approximately equal but opposite directions by insulin and S-oxalylglutathione. These findings support the suggestion that oxalyl thiolesters may function as an intracellular signal recruited to return insulin to normal levels.

Adipocytes↗
PubMed1996

Specimen collection and storage for diagnostic molecular pathology investigation.

The success of the newest discipline in the diagnostic clinical pathology laboratory, molecular pathology, is dependent on proper collection and storage of both the original and processed (nucleic acid) specimen. This issue will grow in importance as test volumes increase in the diagnostic molecular pathology laboratory. This review is a distillation of a literature review by the Patient Preparation and Specimen Handling Committee of the College of American Pathologists. It describes specific collection, storage, and anticoagulant or preservative requirements based on the diagnostic molecular technique and/or specimen type used for analysis. This review serves as a guide for clinical laboratories interested in appropriate collection and storage of specimens to be used in nucleic acid-based analysis.

DNA↗
PubMed1996

Mitochondrial disorders. Methods and specimen selection for diagnostic molecular pathology.

Mitochondrial DNA is a circular double-stranded macromolecule. Each strand contains 16 569 base pairs. Mutations in mitochondrial DNA, including base substitutions in tRNA or rRNA genes, deletions, duplications, or base substitutions in genes for protein subunits, lead to specific diseases. The ratio of mutated to normal mitochondrial DNA may vary from tissue to tissue (heteroplasmy) in mitochondrial DNA diseases. Therefore, the source of the specimen is important in the evaluation of mitochondrial DNA mutations. Detection method selection is also critical. For example, single-strand conformation polymorphism is not as specific for tRNA mutations as is gene sequencing or amplification of a specific gene by polymerase chain reaction. Care in both specimen collection and analytic method are important in the successful evaluation of patients with a potential mitochondrial DNA disease.

DNA, Mitochondrial↗
PubMed1996

Diagnostic molecular pathology in the twenty-first century.

Diagnostic molecular pathology is expanding rapidly with the aid of the Human Genome Project and the development of potentially user-friendly molecular diagnostic methods. The diagnostic molecular pathology laboratory of the future must be prepared to purify DNA or RNA from a variety of sources and to investigate the sequence of the target genome of interest using automated amplification and hybridization detection systems. There will be a shift in the emphasis from phenotypic to genotypic diagnosis, and the diagnostic molecular pathology laboratory of the early twenty-first century will perform 5% to 10% of the volume of all laboratory testing.

Automation↗
PubMed1996

Specimen stability for DNA-based diagnostic testing.

The use of molecular diagnostic testing is increasing in the clinical setting; therefore, data regarding DNA stability in clinical specimens are essential for correct test performance and interpretation. This study was designed to determine DNA stability in peripheral blood and solid tissue under different storage conditions. DNA quality and yield were assayed by spectrophotometric absorbance, gel electrophoresis, and suitability for Southern hybridization and polymerase chain reaction (PCR), the most widely employed clinical DNA analyses. A second goal of the study was to evaluate DNA stability during storage at 4 degrees C for 1 month to 3 years. The data show that freezing or refrigeration of separated leukocytes is preferable for short- to intermediate-term storage and freezing is preferable for solid tissue. DNA degradation varying from slight to severe is seen inconsistently with such specimens, probably due to sampling of unevenly frozen-tissue areas. Depending on the degree of DNA degradation, analysis may still be possible by PCR and in some cases even by Southern hybridization. Once isolated, DNA was stable at 4 degrees C for at least 3 years. These results suggest a more flexible approach to specimen requirements for molecular pathology, as some samples that would routinely be rejected gave interpretable results.

Blood Cells↗
PubMed1995

Antibodies to carbonic anhydrase in patients with immune cholangiopathies.

BACKGROUND/AIMS: Bile duct epithelia contain an abundance of carbonic anhydrase. Antibodies to this enzyme have been described in autoimmune disorders. Serum from patients with immune-mediated liver diseases was studied to determine whether antibodies to carbonic anhydrase II and/or pyruvate dehydrogenase could distinguish autoimmune cholangitis as immunologically distinct from primary biliary cirrhosis. METHODS: Antibody assays to carbonic anhydrase II (Western blot) and pyruvate dehydrogenase (flow cytometry) were performed on the sera of patients with autoimmune cholangitis (6), primary biliary cirrhosis (12), primary sclerosing cholangitis (12), autoimmune hepatitis (12), and control (Gilbert syndrome; 8). RESULTS: Reactivity to carbonic anhydrase II was detected in 5 of 6 patients with autoimmune cholangitis, 1 of 12 patients with primary biliary cirrhosis, 1 of 12 patients with autoimmune hepatitis, and no other patients. Individuals with autoimmune cholangitis were more likely than the other patients to be reactive to carbonic anhydrase II (P < 0.001). Patients with primary biliary cirrhosis were more reactive to pyruvate dehydrogenase compared with all other groups (P < 0.001). CONCLUSIONS: An antibody to human carbonic anhydrase II is frequently detected in the sera of patients with autoimmune cholangitis and is uncommon or not present in other cholangiopathies. These data provide evidence that autoimmune cholangitis and primary biliary cirrhosis represent distinct entities with unique patterns of immunoreactivity.

Aged↗
PubMed1994

Carbonic anhydrase antibody in sera from patients with endometriosis.

Sera from 16 of 23 (69.6%) patients with endometriosis, a potential autoimmune disease, and 2 of 17 (11.8%) control individuals had autoantibodies against the bovine carbonic anhydrase (CA) molecular weight marker, as determined by the Western blot technique. The reactivity of these antibodies to purified human CA I, human CA II, and two preparations of bovine CA II were investigated. Of the 16 endometriosis patients who were reactive to the bovine CA molecular weight marker, 14 were reactive to at least one purified human CA isoenzyme tested, 8 were reactive to at least one purified bovine CA II, and 2 did not react with any of the CA isoenzymes tested. Variation in cross-reactivity between species and in the biochemical characteristics of various CA isoenzyme preparations may partially explain these findings. Autoantibodies to CA isoenzymes have recently been reported in other autoimmune diseases. Further investigation is required to determine the significance of CA autoantibody production in patients with endometriosis.

Adult↗
PubMed1993

Lactate oxidation for the detection of mitochondrial dysfunction in human skin fibroblasts.

To screen fibroblasts for defects in lactate/pyruvate oxidation, cells were grown to confluence in 25-cm2 flasks, rinsed, and incubated in glucose-free media containing 25 microM L-lactate and 0.1 microCi [D,L-1-14C]lactate. Lactate oxidation was measured as the amount of lactate oxidized in nmol of 14CO2 generated/mg protein/min. Fibroblasts from patients with mitochondrial or peroxisomal disorders had decreased lactate oxidation compared to the control (CON): CON, 1.9 +/- 0.13 nmol/mg/min; neonatal adrenoleukodystrophy (NALD), 0.45 +/- 0.01 (P < 0.001); rhizomelic chondrodysplasia punctata (RCDP), 0.13 +/- 0.002 (P < 0.001); mitochondrial defect of unknown etiology (MIT), 0.77 +/- 0.003 (P < 0.001); pyruvate dehydrogenase (PDH) deficiency, 0.98 +/- 0.02 (P < 0.001). This method is useful for screening fibroblasts for defects in lactate oxidation in patients with mitochondrial or peroxisomal disorders. Confirmation of the site of the defect may then be investigated with specific assays, e.g., PDH, in cellular homogenates: CON, 0.93 +/- 0.02 nmol/mg/min; NALD, 0.55 +/- 0.02; RCDP, 0.44 +/- 0.02; MIT, 0.53 +/- 0.03; PDH deficiency, 0.19 +/- 0.02.

Acidosis, Lactic↗