Alpha-oligodeoxynucleotides (alpha-DNA): a new chimeric nucleic acid analog.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
F Morvan
Publications and source records attributed to F Morvan.
Alpha-DNA VIII: thermodynamic parameters of complexes formed between the oligo-alpha-deoxynucleotides: alpha-d(GGAAGG) and alpha-d(CCTTCC) and their complementary oligo-beta-deoxynucleotides: beta-d(CCTTCC) and beta-d(GGAAGG) are different.
The temperature dependence of the formation of a complex between an alpha-d(CCTTCC) hexanucleotide and its complementary beta-d(GGAAGG) sequence was studied and compared to the formation of the beta-d(CCTTCC):beta-d(GGAAGG) complex. Such alpha-beta complex is more stable than the regular beta:beta complex. The Tm value for the alpha:beta complex is 28 degrees C (delta G degrees = -7.3 kcal/mole) while Tm = 20, 1 degree C (delta G degrees = -6.3 kcal/mole) for the beta:beta complex. The stoechiometry of the alpha:beta complex corresponds to the formation of a 1:1 duplex. However, when the alpha- strand is made of alpha-purines: alpha-d(GGAAGG), the stability of the alpha:beta complex, alpha-d(GGAAGG):beta-d(CCTTCC) is found to be lower (Tm = 13.8 degrees C) than the stability of the regular beta-beta complex, leading to the conclusion that the nature of the alpha-sequence is important in terms of stability when considering the synthesis of such a sequence for using it as antisense oligonucleotide.
Base Composition↗
[In vitro anti-HIV activity of phosphorothioate alpha-anomeric oligodeoxynucleotides].
Oligonucleotide analogs consisting exclusively of alpha-anomeric deoxynucleoside units bridged with phosphorothioate linkages have been synthesized and tested in vitro as antiviral agents against human immunodeficiency virus (HIV) in human T cells. Two 28-mers, an homopolymer alpha-S-dC28 and an oligomer alpha-S-anti-rev complementary to the initiation site of the regulatory viral gene rev exhibited antiviral activities comparable to those reported for the corresponding beta-anomeric phosphorothioate analogs. In contrast, a nuclease-resistant homopolymer, alpha-dC28 was inactive. Their preliminary results would indicate that the origin of oligonucleotide phosphorothioate anti-HIV activity is not exclusively correlated with their higher nuclease resistance.
Base Sequence↗
[Cancer of the breast: intensive treatment with bone marrow autografts].
High dose chemotherapy with autologous bone marrow transplantation has been proposed in metastatic and inflammatory breast cancer. Data in the literature reported an improvement of the quality and of the rate of response. However, the impact on survival remains to be demonstrated. Since 1985, a pilot study in inflammatory and directly metastatic breast cancer has been started in order to determine the impact of high dose chemo-radiotherapy. Patients were treated with an induction regimen consisting of cyclophosphamide 1,200 mg/m2 and 4'epi-adriamycin 75 mg/m2 every 15 days x 4. Mastectomy was performed associated for patients younger than 50 years with bone marrow collection and cryoconservation. In this group, late intensification with cyclophosphamide 2.2 g/m2 day 1 and 2, TBI and autologous bone marrow transplantation was performed. Fourteen patients have been treated: 9 inflammatory breast cancers T4 b N1 M0, 5 metastatic cancers at presentation including 3 with inflammatory breast cancer T4 b N1 M1 and 2 metastatic T2 N1 M1. Relapses had occurred in 7 patients, of them 4 were metastatic. Five patients died from their disease, and one from CMV interstitial pneumonitis. Six patients are alive free of disease but only one was metastatic. On this limited number of patients, survival of metastatic breast cancers does not seem to benefit from this regimen.
Adult↗
Alpha-anomeric DNA: beta-RNA hybrids as new synthetic inhibitors of Escherichia coli RNase H, Drosophila embryo RNase H and M-MLV reverse transcriptase.
Nuclease-resistant alpha-anomeric DNA:beta-RNA hybrids are inhibitors of Escherichia coli RNase H, and Drosophila embryo RNase H. RNase H activities were measured by polyacrylamide gel electrophoresis, employing a short substrate, (A)12:d[G-G-(T)12-G-G], or by acid-solubility techniques, using a long substrate, poly(A):poly(dT). Strand exchanges which could be responsible for the observed inhibition have been ruled out by S1 nuclease experiments and by using inhibitors which do not allow strand exchange. Our results suggest that RNase H, for which DNA:RNA duplexes are the natural substrates, binds to non-physiological alpha-DNA:RNA hybrids and is consequently inhibited. These hybrids also inhibit the RNA-dependent DNA polymerase activity of M-MLV reverse transcriptase, therefore appearing as potential inhibitors of at least two reverse transcriptase activities. However, the inhibitory effect of these hybrids with respect to M-MLV reverse transcriptase is also observed with the single-stranded alpha-DNA itself. Unexpectedly, polymerase activity is highly stimulated by alpha-oligos, analogous in their sequence to the beta primer used at a concentration unable to generate a detectable synthesis. These results suggest that the inhibition of reverse transcriptase activity with the alpha:beta may occur at different levels.
Animals↗
alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.
An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.
Base Sequence↗
alpha-Oligodeoxynucleotide stability in serum, subcellular extracts and culture media.
Degradation of a synthetic alpha-oligodeoxynucleotide was studied in order to compare its survival with naturally occurring beta-oligodeoxynucleotides in five systems used for antisense hybridization arrest experiments. In contrast to beta-oligodeoxynucleotides, alpha-oligodeoxynucleotides were not detectably degraded over 24 h at 37 degrees C in HeLa cell postmitochondrial cytoplasmic extract or RPMI 1640 with 10% fetal bovine serum, and showed significant survival after 24 h at 37 degrees C in rabbit reticulocyte lysate, fetal bovine serum and human serum.
Base Sequence↗
Alpha are more stable than beta anomer oligonucleotides in 3T3 cellular extracts.
We have compared the stability of alpha and beta anomeric oligonucleotides in NIH 3T3 cellular extracts. We had already shown that alpha are much more resistant than beta oligonucleotides towards purified nucleases. This result is confirmed when using cellular extracts although the difference is smaller. When alpha molecules are combined with an intercalating agent binding in the 3' position a synergistic increase of resistance to degradation is observed.
Animals↗
alpha-DNA. VI: Comparative study of alpha- and beta-anomeric oligodeoxyribonucleotides in hybridization to mRNA and in cell free translation inhibition.
alpha and beta-anomeric d(G2T12G2) oligodeoxyribonucleotides were compared for their hybridization to rA12: the observed melting temperatures are 27 degrees C for beta-oligodeoxyribonucleotide/RNA hybrid and 53 degrees C for alpha-oligodeoxyribonucleotide/RNA. alpha-oligonucleotides with the four bases, complementary to natural mRNAs, were synthesized for the first time, labeled at their 5'-end with [32P] and used as probes in Northern blot experiments. In spite of these higher affinities for their target RNA's, they were unable to block translation of natural or synthetic mRNA's in rabbit reticulocyte lysate. We have studied the RNase H activity on model rA12:alpha- or beta-d(G2T12G2) hybrids or on mRNA:alpha- or beta-oligonucleotides hybrids. Specific hybridization protects RNA strech when using alpha-oligonucleotides but not beta-oligonucleotides. Thus, our results show the inability of RNase H to degrade RNA in alpha-oligodeoxyribonucleotides:RNA duplexes.
Endoribonucleases↗
alpha-DNA-V. Parallel annealing, handedness and conformation of the duplex of the unnatural alpha-hexadeoxyribonucleotide alpha-[d(CpApTpGpCpG)] with its beta-complement beta-[d(GpTpApCpGpC)] deduced from high field 1H-NMR.
The beta-complementary hexamer, beta-d[GTACGC], to the alpha-sequence, alpha-d[CATGCG], was synthesized by the phosphotriester method. The non-exchangeable proton assignments were obtained using 1D- and 2D-NMR techniques, including NOE, COSY and NOESY. The beta-strand exists as a random coil at 21 degrees C; however, at 4 degrees C, it forms an antiparallel self-recognition duplex annealing at positions 1-4. The beta-strand was annealed to the alpha-strand, and confirmation of complete annealing was obtained by detection and assignment of the six base pair imino protons in H2O/D2O solution at 21 degrees C. 1D-NOE experiments of the alpha, beta duplex d[alpha-(CATGCG) X beta-(GTACGC)] reveal that (i) it exists in aqueous solution in a conformation that belongs to the B family, (ii) it is 70 +/- 10% right-handed, (iii) the sugar-base orientations of the beta-strand are anti, and the deoxyribose units exist predominantly in the 2'-endo-3'-exo conformation. NOE measurements of the imino proton signals in the alpha, beta duplex reveal that the duplex exhibits parallel polarity.
Base Composition↗
Alpha-DNA. IV: Alpha-anomeric and beta-anomeric tetrathymidylates covalently linked to intercalating oxazolopyridocarbazole. Synthesis, physicochemical properties and poly (rA) binding.
A new set of molecules made of an intercalating agent (oxazolopyridocarbazole, OPC) covalently linked through a polymethylene chain of various length to the 3' end of alpha-anomeric or beta-anomeric tetradeoxynucleotides (alpha- or beta-T4) have been synthesized. The beta-thymidylate modified compound (beta-T4C5OPC) is able to interact with the complementary sequence, beta-poly (rA); this interaction is strongly stabilized compared to the parent compound, beta-oligo(dT)4 and is specific for poly (rA). The molecule synthesized from the unnatural alpha-anomer, alpha-T4C5OPC, is also able to interact with poly (rA) leading to the formation of an alpha-beta hybrid stabilized by the energy provided by the OPC moiety. The stoechiometry of the binding reaction shows that an A-T pairing occurs in the alpha-beta heterohybrids. Tm studies reveal that the alpha-beta heterohybrids are more stable than their beta-beta counterparts.
Base Sequence↗
alpha-DNA-III. Characterization by high field 1H-NMR, anti-parallel self-recognition and conformation of the unnatural hexadeoxyribonucleotides alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)]. Alpha-oligodeoxynucleotides as potential cellular probes for gene control.
High field 2-D-1H-NMR techniques permitted the assignment of all non-exchangeable protons of the unnatural deoxyribonucleotides alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)]. 1-D and 2-D NOESY experiments show strong H6H8-H4' dipolar interactions for all nucleotides in both sequences. These data, together with COSY and J-resolved spectra, indicate that these two alpha-oligomers adopt 3'-exo conformations of the sugar moieties in solution with anti conformations of the glycosyl linkages. Both 1H-NMR data, and hypochromocity comparison of alpha-CATGCG and beta-CATGCG, demonstrate a higher degree of base stacking in the case of the alpha-sequence. The UV hyperchromicity at 260 nm, and symmetry considerations in the imino proton NMR experiments reveal antiparallel self-recognition and duplex annealing at positions 1-4 for alpha-[d(CATGCG)] and positions 3-6 for alpha-[d(CGCATG)]. The temperature variation of the imino proton NMR signals suggests that the hydrogen bonding in self-recognition is comparable in strength with that in a beta-DNA duplex, and NOE data are in accord with Watson-Crick rather than Hoogsteen base pairing.
Gene Expression Regulation↗
alpha-DNA II. Synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides containing the four usual bases and study of their substrate activities for nucleases.
This paper describes for the first time the synthesis of alpha-oligonucleotides containing the four usual bases. Two unnatural hexadeoxyribonucleotides: alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)], consisting only of alpha-anomeric nucleotide units, were obtained by an improved phosphotriester method, in solution. Starting material was the four base-protected alpha-deoxyribonucleosides 3a-d. Pyrimidine alpha-deoxynucleosides 3a and 3b were prepared by self-anomerization reactions followed by selective deprotection of sugar hydroxyles, while the two purine alpha-deoxynucleosides 3c and 3d were prepared by glycosylation reactions. In the case of guanine alpha-nucleoside derivative a supplementary base-protecting group: N,N-diphenylcarbamoyl was introduced on O6-position in order to avoid side-reactions during oligonucleotide assembling. The hexadeoxynucleotide alpha-[d(CpApTpGpCpG)] was tested as substrate of selected endo- and exonucleases. In conditions where the natural corresponding beta-hexamer was completely degradated by nuclease S1 and calf spleen phosphodiesterase, the alpha-oligonucleotide remained almost intact.
Deoxyribonucleases↗
[Pregnancy after treated breast cancer. Results of a case-control study].
Sixty-eight cases of pregnancy after carcinoma of the breast were collected during a survey conducted by the Société Française de Gynécologie: 27 patients had one or several pregnancies interrupted at an early stage; 41 patients had at least one uninterrupted pregnancy. The fate of these patients was compared to that of 136 controls similar in all respects, except for the absence of post-cancer pregnancy. There was no significant difference in survival curves: the 10-year survival rate in our 68 patients was 71% (90% in those with N- cancer; 71% in those with N+ cancer, with no significant difference between cases and controls in each group). The patients whose pregnancies were interrupted had the same prognosis as those who delivered at term. The survival of 14 patients who conceived within 6 months of the breast cancer treatment was not significantly different from that of the corresponding controls. Pregnancy after breast cancer does not seem to alter the prognosis of the disease. In women with good prognosis cancer, the survival rate is excellent whatever the delay between cancer and pregnancy, and women should not be discouraged from having children; in women with poor prognosis cancer (N+), the outcome is not modified by pregnancy, and it remains lethal in about 50% of cases.
Adult↗
alpha-DNA. I. Synthesis, characterization by high field 1H-NMR, and base-pairing properties of the unnatural hexadeoxyribonucleotide alpha-[d(CpCpTpTpCpC)] with its complement beta-[d(GpGpApApGpG)].
The novel deoxyribonucleotide alpha-[d(CpCpTpTpCpC)] and its complement beta-[d(GpGpApApGpG)] were synthesized by the phosphotriester method. 1H-NMR-NOE examination of the alpha-hexamer revealed that the cytosine and thymine bases appear to adopt anti conformations in this strand. In addition the deoxyribose of the thymidine moieties may adopt average conformations approximating to C3'-endo while the cytidine furanose groups are close to C2'-endo conformations. Both hyperchromicity in thermal melting and detection of base paired imino protons in 1H-NMR studies in H2O provide evidence for the annealing of alpha-d[CCTTCC] with its complement beta-d[GGAAGG] in potassium phosphate buffer pH 7.1 containing 10 mM magnesium chloride. Under these conditions thermal melting begins at 38 degrees C and its complete at approximately 45 degrees C. NOE experiments do not permit a decision on the polarity of annealing (predicted to be parallel) for this particular pair of sequences.
Chemical Phenomena↗
[Teratogenic and mutagenic risks of radiotherapy: when and how to prescribe contraception].
Explore the source record for details and available documents.
Age Factors↗
[Treatment of advanced epidermoid carcinoma of the oesophagus with combined 5-fluorouracil, adriamycin and cis-platinum (FAP)].
Twenty-one patients with advanced, inoperable epidermoid carcinoma of the oesophagus were treated with combined 5-fluorouracil (F, 600 mg/m2, days 1 and 8), adriamycin (A, 30 mg/m2, day 1) and cis-platinum (C, 75 mg/m2, day 1), together with hydratation and mannitol-induced diuresis. Each course was repeated after 4 weeks. Response could be assessed in all 21 patients and was objective in seven (33%), who had metastasis prior to treatment. Two of these 7 patients went into complete remission confirmed by negative endoscopy and pathology; 5 showed partial response. Median survival of the 21 patients was 8 months; it fell to 4.5 months in non-responders and rose over 9 months in responders. Three patients survived for more than 16 months. No severe bone marrow depression or nephrotoxicity was observed. The 3-drug combination appeared to be more effective than the additive effects of each drug given separately. It is concluded that the FAP regimen is useful in the treatment of advanced oesophageal tumours.
Adult↗
[Hydatid cyst of the kidney. (Apropos of 26 personal cases)].
Explore the source record for details and available documents.
Adolescent↗