Biomedical subjects

F W Keeley

Publications and source records attributed to F W Keeley.

At least 19 recordsLinked to original sources

PubMed2007

Microstructural and tensile properties of elastin-based polypeptides crosslinked with genipin and pyrroloquinoline quinone.

Elastin is an elastomeric, self-assembling extracellular matrix protein with potential for use in biomaterials applications. Here, we compare the microstructural and tensile properties of the elastin-based recombinant polypeptide (EP) EP20-244 crosslinked with either genipin (GP) or pyrroloquinoline quinone (PQQ). Recombinant EP-based sheets were produced via coacervation and subsequent crosslinking. The micron-scale topography of the GP-crosslinked sheets examined with atomic force microscopy revealed the presence of extensive mottling compared with that of the PQQ-crosslinked sheets, which were comparatively smoother. Confocal microscopy showed that the subsurface porosity in the GP-crosslinked sheets was much more open. GP-crosslinked EP-based sheets exhibited significantly greater tensile strength (P < or = 0.05). Mechanistically, GP appears to yield a higher crosslink density than PQQ, likely due to its capacity to form short-range and long-range crosslinks. In conclusion, GP is able to strongly modulate the microstructural and mechanical properties of elastin-based polypeptide biomaterials forming membranes with mechanical properties similar to native insoluble elastin.

Cross-Linking Reagents↗

PubMed2006

Differential expression of two tropoelastin genes in zebrafish.

Elastin is the extracellular matrix protein responsible for properties of extensibility and elastic recoil in large blood vessels, lung and skin of most vertebrates. Elastin is synthesized as a monomer, tropoelastin, but is rapidly transformed into its final polymeric form in the extracellular matrix. Until recently information on sequence and developmental expression of tropoelastins was limited to mammalian and avian species. We have recently identified and characterized two expressed tropoelastin genes in zebrafish. This was the first example of a species with multiple tropoelastin genes, raising the possibility of differential expression and function of these tropoelastins in elastic tissues of the zebrafish. Here we have investigated the temporal expression and tissue distribution of the two tropoelastin genes in developing and adult zebrafish. Expression was detected early in skeletal cartilage structures of the head, in the developing outflow tract of the heart, including the bulbus arteriosus and the ventral aorta, and in the wall of the swim bladder. While the temporal pattern of expression was similar for both genes, the upregulation of eln2 was much stronger than that of eln1. In general, both genes were expressed and their gene products deposited in most of the elastic tissues examined, with the notable exception of the bulbus arteriosus in which eln2 expression and its gene product was predominant. This finding may represent a sub-specialization of eln2 to provide the unique architecture of elastin and the specific mechanical properties required by this organ.

Amino Acid Sequence↗

PubMed2005

Patterns of proopiomelanotropin and proopiocortin gene expression and of immunohistochemistry for gonadotropin-releasing hormones (lGnRH-I and III) during the life cycle of a nonparasitic lamprey: relationship to this adult life history type.

There are two adult life history types among lamprey species, nonparasitic and parasitic, with the former commencing the final interval of sexual maturation immediately after metamorphosis. There are no extensive studies that directly compare hormone profiles during the life cycles of nonparasitic and parasitic lamprey species, yet such data may explain differences in development, reproductive maturation, and feeding status. The present study uses immunohistochemistry to show the life cycle profiles for gonadotropin-releasing hormones (GnRH-I and -III) in the brain of the nonparasitic species, the American brook lamprey, Lampetra appendix, for comparison with the extensive, published, immunohistochemical data on these hormones in the parasitic species, the sea lamprey, Petromyzon marinus. The complete cDNAs for the two lamprey prohormones, proopiocortin (POC), and proopiomelanotropin (POM), were cloned for L. appendix and both nucleotide and deduced amino acid sequences were compared with those previously published for P. marinus. The POC and POM cDNAs for both species were used in expression studies, with Northern blotting, throughout their life cycles. Although GnRH-I and -III immunohistochemistry revealed a similar distribution of immunoreactive cells and fibers in the two species during the life cycles, a qualitative evaluation of staining intensity in L. appendix, implied early activity in the brains of metamorphosis of this species, particularly in GnRH-I. GnRH-III seems to be important in larval life and early metamorphosis in both species. A novel feature of this immunohistochemical study is the monthly observations of the distribution and relative intensity of the two GnRHs during the critical period of final sexual maturation that lead to spawning and then the spent animal. L. appendix POC and POM nucleotide sequences had 92.9 and 94.6% identity, respectively, with P. marinus POC and POM and there was an earlier increase in their expression during metamorphosis and postmetamorphic life. Since there was some correlation between the timing of metamorphic development, gonad maturation, and brain irGnRH intensity with POC and POM expression in L. appendix, it was concluded that these prohormones yield posttranslational products that likely play a substantial role in development and maturation events that lead to the nonparasitic adult life history of this species.

Amino Acid Sequence↗

PubMed2001

Self-aggregation characteristics of recombinantly expressed human elastin polypeptides.

Elastin is an extracellular matrix protein found in tissues requiring extensibility and elastic recoil. Monomeric elastin has the ability to aggregate into fibrillar structures in vitro, and has been suggested to participate in the organization of its own assembly into a polymeric matrix in vivo. Although hydrophobic sequences in elastin have been suggested to be involved in this process of self-organization, the contributions of specific hydrophobic and crosslinking domains to the propensity of elastin to self-assemble have received less attention. We have used a series of defined, recombinant human elastin polypeptides to investigate the factors contributing to elastin self-assembly. In general, coacervation temperature of these polypeptides, used as a measure of their propensity to self-assemble, was influenced both by salt concentration and polypeptide concentration. In addition, hydrophobic domains appeared to be essential for the ability of these polypeptides to self-assemble. However, neither overall molecular mass, number of hydrophobic domains nor general hydropathy of the polypeptides provided a complete explanation for differences in coacervation temperature, suggesting that the specific nature of the sequences of these hydrophobic domains are an important determinant of the ability of elastin polypeptides to self-assemble.

Amino Acid Sequence↗

PubMed2001

The unusual cartilaginous tissues of jawless craniates, cephalochordates and invertebrates.

A collagenous extracellular matrix was previously considered to be a requirement for classification of true cartilage. Data from the lamprey and hagfish now clearly indicate that both of these jawless craniates have extensive non-collagenous, yet cartilaginous endoskeletons. Non-collagenous cartilages are present in the cephalochordates (amphioxus) and in the invertebrates, although collagen-containing cartilages also are found in the invertebrates. This review summarizes current knowledge of the morphological, biochemical and molecular characteristics of the unusual non-collagenous cartilages in jawless craniates and the cartilaginous tissues in amphioxus and invertebrates. A least two types of non-collagenous cartilage matrix proteins are found in both the hagfishes and the lampreys, all of which are resistant to digestion by cyanogen bromide (CNBr). Although all four of these matrices show some similarities with each other, suggesting a family of non-collagenous, elastin-like proteins, it is clear that the major matrix proteins of each are different. New morphological and biochemical information on the cartilaginous tissues in squid, horseshoe crab and amphioxus reveals the presence of CNBr-insoluble, non-collagenous matrix proteins, potentially extending the jawless craniate family of cartilaginous proteins into the invertebrates. Details of the evolutionary relationships between these non-collagenous matrix proteins and the significance of the occurrence of these proteins as the major components of the cartilaginous tissues of jawless craniates, amphioxus, horseshoe crab and squid, all of which are capable of producing a variety of collagens in other tissues, remain to be investigated.

Amino Acids↗

PubMed2000

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.

3' Untranslated Regions↗

PubMed2000

Distinct non-collagen based cartilages comprising the endoskeleton of the Atlantic hagfish, Myxine glutinosa.

Previous evidence from our laboratories showed that collagen is not the major matrix protein of the cartilaginous endoskeleton of the lamprey (Petromyzon marinus). Here we have characterized the cartilage matrix proteins of the only other extant agnathan, the hagfish (Myxine glutinosa). Using morphological, immunochemical and biochemical methods, we show that the structural proteins of the cartilaginous endoskeleton of the hagfish are also non-collagenous in nature. Although these hagfish cartilage proteins share properties both with each other and with lamprey cartilage proteins, including resistance to solubilization with cyanogen bromide and an usual amino acid composition rich in glycine and non-polar amino acids, it is clear that at least two and probably more hagfish cartilage proteins can be distinguished, with distinct distributions in different cartilage structures. Furthermore, in spite of their similarities, matrix proteins from hagfish cartilage are not identical to the proteins we have previously characterized in lamprey cartilage. These results suggest the existence of a larger family of similar but not identical proteins that form the major structural elements of cartilage tissues of agnathans. These data also support our previous conclusion that type II collagen became the predominant structural protein of cartilage only after the divergence of the agnathans from the ancestral line of the vertebrates.

Amino Acids↗

PubMed2000

The structure and organization of lamprin genes: multiple-copy genes with alternative splicing and convergent evolution with insect structural proteins.

Lamprin is a unique structural protein which forms the extracellular matrix of several cartilaginous structures found in the lamprey. Lamprin is noncollagenous in nature but shows sequence similarities to elastins and to insect structural proteins. Here, we characterize the structure and organization of lamprin genes, demonstrating the presence of multiple similar but not identical copies of the lamprin gene in the genome of the lamprey. In at least one species of lamprey, Lampetra richardsoni, the multiple gene copies are arranged in tandem in the genome in a head-to-tail orientation. Lamprin genes from Petromyzon marinus contain either seven or eight exons, with exon 4 being alternatively spliced in all genes, resulting in a total of six different lamprin transcripts. All exon junctions are of class 1,1. An unusual feature of the lamprin gene structure is the distribution of the 3' untranslated region sequence among multiple exons. A TATA box and cap sequence have been identified in upstream sequences in close proximity to the transcription start site, but no CAAT box could be identified. Sequence and gene structure comparisons between lamprins, elastins, and insect structural proteins suggest that the regions of sequence similarity are the result of a process of convergent evolution.

Alternative Splicing↗

PubMed1999

Identification of a large region of secondary structure in the 3'-untranslated region of chicken elastin mRNA with implications for the regulation of mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal vascular development. Our laboratory has previously shown that changes in elastin mRNA stability contribute to this developmental decrease in elastin production. Here we identify a large region of stable secondary structure in the 3'-untranslated region (3'-UTR) of chicken elastin mRNA. Reverse transcriptase polymerase chain reaction or polymerase chain reaction amplification of the 3'-UTR consistently resulted in products with an approximately 328-bp deletion from the central region of the 3'-UTR, suggesting the presence of secondary structure. The presence of this structure was confirmed by probing the 3'-UTR with RNases with selectivity for single- or double-stranded RNA. Gel migration shift assays using cytosolic extracts from 2-day old chicken aorta demonstrate specific binding of a cytosolic protein to riboprobes containing the 3'-UTR of elastin but not to riboprobes either corresponding to other areas of the message or containing the 3'-UTR but lacking the region of secondary structure. Binding of cytosolic protein was particularly prominent in aortic extracts from 2-day old chickens, a time when elastin message is stable, as compared with 8- and 15-week old chickens, when the elastin message is relatively unstable, suggesting that this region of secondary structure may play a role in developmental regulation of stability of elastin mRNA.

Animals↗

PubMed1998

Partial clone of the gene for AS protein of the lamprey Petromyzon marinus, a member of the albumin supergene family whose expression is restricted to the larval and metamorphic phases of the life cycle.

AS was previously found to be a liver-synthesized serum protein that is found in the larval (ammocoete), metamorphosing, and juvenile individuals during the life cycle of Petromyzon marinus but not in the sexually mature upstream-migrant individuals (Filosa et al. [1982] Comp. Biochem. Physiol., 72B:521-530; [1986] Comp. Biochem. Physiol., 83B:143-149; Ito et al. [1988] J. Exp. Zool., 245:256-263). In the present work, a partial clone for the gene for the AS protein was isolated from a cDNA expression library made from ammocoete liver. Northern blots using this clone showed hybridization with mRNA from the intervals of the life cycle prior to the upstream-migration period but not from the upstream-migration period itself. The cloned DNA was sequenced and the deduced amino acid sequence was found to have 40% identity with an albumin (our SDS-1 protein) from the upstream migrants of P. marinus (Gray and Doolittle, [1992] Protein Sci., 1:289-302), which is homologous to mammalian serum albumin. Thus the lamprey has two genes, AS and SDS-1, that code for different but similar albumin-like proteins, which predominate at different phases in its life cycle. It is suggested that AS protein, because it is present only at the earlier phases of the life cycle and because its gene is transcribed only during this same period, may be an early version of the alpha-fetoprotein (AFP) of mammals that is found only in the embryonic, fetal, and neonatal phase of their life cycle.

Albumins↗

PubMed1998

Spatial and temporal distribution of proopiomelanotropin and proopiocortin mRNA during the life cycle of the sea lamprey: a qualitative and quantitative in situ hybridization study.

Two POMC-like pituitary prohormones proopiocortin (POC) and proopiomelanotropin (POM) have been characterized from adult sea lampreys (Petromyzon marinus). POC encodes a nasohypophysial factor (NHF), ACTH, an MSH, and beta-END; and POM encodes MSH-A, MSH-B, and beta-END. Two radiolabeled riboprobes, one encoding a unique portion of POC mRNA and the other encoding the MSH-B domain unique to POM mRNA, were generated in order to examine the expression of POC and POM during the life cycle of the sea lamprey by in situ hybridization. POC expression appears evenly distributed throughout most cells of the rostral pars distalis (RPD) during the entire life cycle. POC expression also occurs in scattered cells of the caudal (proximal) pars distalis (CPD) at stage 5 of metamorphosis. By the prespawner period, POC expression is mainly distributed in the dorsal aspect of this region. POM expression was completely confined to most cells of the pars intermedia (PI) at all periods examined. Quantitative, computer-assisted, image analysis of POM expression revealed high signal densities in all larvae which decreased by early metamorphosis, steadily increased and reached high levels by late metamorphosis (stages 6 and 7), and attained even higher levels in prespawners. Volumetric analysis revealed that the net volume of POM expressing cells is at its lowest in larvae and increases during subsequent development. Analysis of signal density and volumetric measurements of POC expression revealed that POC expression in the RPD is low in larvae and steadily increases during subsequent intervals of the life cycle reaching very high levels by the prespawning period. POC expression in the CPD, first visible at stage 5, increases steadily throughout the remainder of metamorphosis and reaches the highest levels of expression in prespawning animals. These results would implicate the role of POM and POC in some developmental processes but not in the initiation of metamorphosis. The very high levels of POM and POC expression in prespawner animals suggest that the two genes may have important roles at this time in the life cycle of lampreys.

Animals↗

PubMed1998

Identification and characterization of a serpin with differential expression during the life cycle of the sea lamprey.

We have cloned a member of the serine proteinase inhibitor gene superfamily from the sea lamprey, Petromyzon marinus. The predicted translation product contains a putative signal peptide and mRNA expression is localized mainly to the liver. Northern blot analysis indicates that the mRNA increases in the larvae and peaks in late larval life. At the onset of metamorphosis there is a approximately 10-fold drop after which it remains low. These changes correspond with levels of circulating thyroid hormone suggesting that this serpin is involved in or regulated by molecular signals that induce metamorphosis in the lamprey. Use of alignments and structural information from other serpins indicates that the lamprey serpin has the potential to be inhibitory. In addition the lamprey serpin contains methionine and serine at the P1 and P1' positions, respectively. Appropriate residues at positions important in allowing the insertion of strand s4A into beta-sheet A that occurs upon cleavage in inhibitory serpins are also found in the lamprey serpin.

Amino Acid Sequence↗

PubMed1998

Arterial vasodilation and vascular connective tissue changes in spontaneously hypertensive rats.

Arterial hypertrophy in response to hypertension includes increases in the connective tissue proteins elastin and collagen. Regression of arterial hypertrophy depends not only on blood pressure normalization but also on the specific antihypertensive treatment. Consequently, each drug class may exert an influence on connective tissue proteins. We evaluated the arterial connective tissue response of 16-week-old spontaneously hypertensive rats (SHRs) to treatment with minoxidil, 120 mg/L, drinking water for 10 weeks. Despite a decrease in blood pressure, minoxidil had no effect on arterial weight or collagen content but increased elastin content in the abdominal aorta, renal, and superior mesenteric arteries. The increase in elastin content in the abdominal aorta and superior mesenteric artery was accompanied by a decrease in tissue elastase activity. Thus the minoxidil-induced increase in arterial elastin content may be related to a direct effect of the drug to decrease elastase activity in these tissues.

Animals↗

PubMed1996

Spatial and temporal distribution of lamprin mRNA during chondrogenesis of trabecular cartilage in the sea lamprey.

The temporal and spatial expression patterns of lamprin, the principle structural protein in lamprey cartilages, were examined by in situ hybridization during chondrogenesis of trabecular cartilage in day 17-33 post-fertilization prolarval lampreys. Lamprin mRNA transcripts were first detected during day 19, concomitant with the end of the condensation phase of chondrogenesis and the initiation of matrix synthesis as indicated by light microscopic examination. In the stages which followed, the hybridization signal increased with progressive intensity, paralleling matrix synthesis, suggesting transcriptional control of lamprin gene expression. Spatially, lamprin expression patterns mirrored the rostrocaudal development of the trabecular cartilage rudiment. No signal was detected over adjacent tissues or control sections. Some similarities exist between the temporal patterns of lamprin expression and the expression of matrix proteins such as elastin and collagen of higher vertebrates. It is concluded that certain aspects of chondrogenesis are critical to the normal development of a functional cartilaginous matrix and are conserved throughout the vertebrate taxa.

Animals↗

PubMed1996

In vivo collagen turnover following experimental balloon angioplasty injury and the role of matrix metalloproteinases.

Extracellular matrix formation is the major component of the restenosis lesion that develops after balloon angioplasty. Although ex vivo studies have shown that the synthesis of collagen is stimulated early after balloon angioplasty, there is a delay in accumulation in the vessel wall. The objectives of this study were to assess collagen turnover and its possible regulation by matrix metalloproteinases (MMPs) in a double-injury iliac artery rabbit model of restenosis. Rabbits were killed at four time points (immediately and at 1, 4, and 12 weeks) after balloon angioplasty. In vivo collagen synthesis and collagen degradation were measured after a 24-hour incubation with [14C]proline. Arterial extracts were also run on gelatin zymograms to determine MMP (gelatinase) activity. Collagen turnover studies were repeated in a group of 1-week postangioplasty rabbits that were treated with daily subcutaneous injections of either a nonspecific MMP inhibitor, GM6001 (100 mg/kg per day), or placebo. Collagen synthesis and degradation showed similar temporal profiles, with significant increases in the balloon-injured iliac arteries compared with control nondilated contralateral iliac arteries immediately after angioplasty and at 1 and 4 weeks. Peak collagen synthesis and degradation occurred at 1 week and were increased (approximately four and three times control values, respectively). Gelatin zymography was consistent with the biochemical data by showing an increase of a 72-kD gelatinase (MMP-2) in the balloon-injured side immediately after the second injury, peaking at 1 week, and still detectable at 4 and 12 weeks (although at lower levels). In balloon-injured arteries, the MMP inhibitor reduced both collagen synthesis and degradation. Overall, at 1 week after balloon angioplasty, GM6001 resulted in a 33% reduction in collagen content in balloon-injured arteries compared with placebo (750 +/- 143 to 500 +/- 78 micrograms hydroxyproline per segment, P < .004), which was associated with a nonsignificant 25% reduction in intimal area. Our data suggest that degradation of newly synthesized collagen is an important mechanism regulating collagen accumulation and that MMPs have an integral role in collagen turnover after balloon angioplasty.

Angioplasty, Balloon↗

PubMed1996

Detection of lamprin mRNA in the anadromous sea lamprey using in situ hybridization.

An optimal in situ hybridization protocol is described for the detection of gene expression of a structural protein unique to lampreys, lamprin, in the cartilages of prolarval, metamorphic and adult sea lamprey, Petromyzon marinus. A 156 bp antisense RNA probe labeled with (35)S-UTP was transcribed in vitro from a recombinant plasmid containing a cDNA insert homologous to the largest (1.8 kb) of three known mRNAs for the lamprin gene and hybridized to 6 mu m paraffin sections. Optimal signal to noise ratio was achieved by fixing tissues 30 min in 4% paraformaldehyde and prehybridizing with a probe incorporating a nonradioactive S-UTP. Strong signals were visualized in all cartilaginous elements of the lamprey neurocranium; however, lamprin mRNA transcripts were not detected in branchial and pericardial cartilages suggesting differential expression of the lamprin gene. No signals were observed in tissue sections that had been treated with RNase A prior to hybridization or in sections hybridized with sense RNA probes. This technique has great potential for use in studies of the spatial and temporal distribution of cartilaginous components during developmental stages of lampreys.

Animals↗

PubMed1995

Elastin in systemic and pulmonary hypertension.

Increased elastin production and accumulation is a rapid and sensitive response to elevated vascular wall stress in both systemic and pulmonary hypertension. While initially protecting the vessel wall, these structural changes may in the longer term result in reinforcement of the hypertensive state and contribute to the persistence of the pathology of hypertension. Rapid responses apparently uncorrelated with increased elastin mRNA, at least in the case of systemic vessels, suggest novel mechanisms perhaps including increased efficiency of message translation or matrix accumulation of the protein. Investigations using in vitro organ and cell culture models have indicated a role for phospholipases and protein kinases, including protein kinase C, in stretch-induced elastin synthesis. In addition, tyrosine phosphorylation of membrane/sub-membrane/cytoskeletal sensors, including focal adhesion kinase and members of the lipocortin family, have been shown to be important in this transduction mechanism. Because its turnover is normally very slow, additional vascular elastin accumulated during hypertensive episodes, together with its consequences for the physical properties of the vessel wall, may persist long after blood pressure is restored to normal levels. Thus, recent interest has been drawn to the possibility of achieving regression of accumulated matrix elastin by promoting turnover of this protein through activation of endogenous vascular elastase and collagenase activities.

Animals↗

PubMed1995

Recycling of the 67-kDa elastin binding protein in arterial myocytes is imperative for secretion of tropoelastin.

We have shown previously that the 67-kDa elastin binding protein (EBP) colocalizes intracellularly and extracellularly with tropoelastin in fetal sheep aorta, suggesting that these two proteins associate along the secretory pathway. Moreover, we have established that association with EBP protects tropoelastin from serine proteinases and from intracellular coacervation, and is necessary for its proper extracellular assembly. Since the production of tropoelastin by aortic smooth muscle cells (Ao SMC) exceeds production of the EBP, we speculated that this binding protein might recycle back into the cell, associating again with newly synthesized tropoelastin. In this report we labeled cultured Ao SMC externally with the F(ab')2 fragments of immunoglobulin which recognizes sheep EBP and followed trafficking of EBP by immunofluorescence and electron microscopy. Our results indicate that the majority of the EBP residing on the cell surface can be internalized to endocytic compartments (but not to lysosomes) and recycled back to the plasma membrane within 45-60 min. We have also determined that reagents disturbing pH of distinct endocytic compartments (chloroquine and bafilomycin A1, but not ammonium chloride) arrest recycling of the EBP and, at the same time, strongly inhibit deposition of insoluble elastin in cultures of sheep Ao SMC and in organ cultures of chicken aorta. In contrast, neither chloroquine nor bafilomycin A1 inhibit total protein synthesis or synthesis of tropoelastin. Our results suggest that the EBP serves as a reusable shuttle protein for tropoelastin and that its recycling is essential for effective deposition of insoluble elastin.

Animals↗