PubMed Health⌕ Search

Biomedical subjects

G Krupp

Publications and source records attributed to G Krupp.

64 records · Page 4Linked to original sources
PubMed1983

Small cytoplasmic RNAs from rat liver mRNP particles. Studies on their structure and function.

Free cytoplasmic 40S mRNP particles from rat liver were treated with EDTA and separated into two populations of RNP particles with sedimentation maxima of 20S and 35S, respectively. A characteristic set of distinct scRNAs is found for 20S and 35S RNP particles. The sequences of two of the most abundant scRNAs from 20S RNP particles with chain lengths of 104 (alpha 1-RNA) and 124 (beta 1-RNA) nucleotides, respectively, are presented. alpha 1-RNA shows a high sequence homology to the 3'-end of 18S rRNA. Since alpha 1-RNA carries a cap, it cannot be a degradation product of 18S rRNA. The beta 1-RNA is strongly post-transcriptionally modified, but uncapped. When the individual scRNAs of 20S and 35S RNP particles isolated from preparative polyacrylamide gels were assayed for their capability to inhibit in vitro protein synthesis, several potent translational inhibitory RNAs were detected. Particularly, the scRNAs of 147,203 and 263 nucleotide length associated with the 35S RNP particles turned out to be strong inhibitors of protein synthesis.

Animals↗
PubMed1983

[Heterogeneity of the poly(C) tract of encephalomyocarditis virus RNA].

The nucleotide sequence of the RNase T1-resistant fragment of encephalomyocarditis virus RNA that includes the poly(C) tract was determined by gel sequencing and mobility shift methods. This sequence is (5') AC126(127) UCUCUCUC9UAACG (3'). The results show that the poly(C) tract is discontinuous, i.e., it is interrupted by the UCUCUCU-sequence. The tract displays anomalously high mobility in polyacrylamide gels as compared to random polynucleotides, indicating that electrophoretic determination of its length gives underestimated values.

Base Sequence↗
PubMed1982

The nucleotide sequence of 5.8S rRNA from the posterior silk gland of the silkworm Philosamia cynthia ricini.

The nucleotide sequence of 5.8S rRNA from the Chinese silkworm Philosamia cynthia ricini has been determined by gel sequencing and mobility shift methods. The complete primary structure is (sequence in text). This is one of the largest known 5.8S rRNAs. As compared to Bombyx 5.8S rRNA, it is two nucleotides longer; two nucleotides near the 5'end and two nucleotides near the 3'end are different, and psi 61 of the Bombyx RNA sequence is an unmodified U in Philosamia RNA. The secondary structure of Philosamia 5.8S rRNA may differ from the Bombyx RNA structure by three additional base pairs at the 5'/3' ends.

Animals↗
PubMed1982

Nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid.

The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt viroid (CSV, propagated in Cineraria) has been established, using labelling in vitro and direct RNA sequencing methods and a new screening procedure for the rapid selection of suitable RNA fragments from limited digests. The covalently closed circular single-stranded viroid RNAs consist of 371 (CEV) and 354 (CSV) nucleotides, respectively. As previously shown for potato spindle tuber viroid (PSTV, 359 nucleotides), CEV and CSV also contain a long polypurine sequence. Maximal base-pairing of the established CEV and CSV sequences results in an extended rod-like secondary structure similar to that previously established for PSTV and as predicted from detailed physicochemical studies of all these viroids. Although the three viroid species sequenced to date differ in size and nucleotide sequence, there is 60--73% homology between them. As PSTV, CEV and CSV also contain conserved complementary sequences which are separated from each other in the native secondary structure. We postulate that the resulting 'secondary' hairpins, being formed and observed in vitro during the complex process of thermal denaturation of viroid RNA, must have a vital, although yet unknown, function in vivo. The possible origin and function of viroids are discussed on the basis of the characteristic structural features and of a considerable homology with U1a RNA found for a region highly conserved in the three viroids.

Base Sequence↗
PubMed1981

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.

Base Sequence↗
PubMed1981

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Base Sequence↗
PubMed1979

Rapid RNA sequencing: nucleases from Staphylococcus aureus and Neurospora crassa discriminate between uridine and cytidine.

Using end-labelled RNA, significant changes in base specificity of three nucleases have been detected under defined conditions. Staphylococcus aureus nuclease at pH 3.5 without Ca++ cleaves all Pyr-N bonds more uniformly and efficiently than RNase A, without any preference for Pyr-A bonds. At pH 7.5 in 10 mM Ca++ this enzyme cleaves all N-C and N-G bonds slowly, whereas N-U and N-A bonds are hydrolyzed rapidly. Hence, the base at the 3'- or at the 5'-side of a phosphodiester bond can determine the base specificity of S. aureus nuclease. - In absence of urea, Neurospora crassa endonuclease cleaves all phosphodiester bonds, but leaves all C-N bonds intact in 7 M urea. - RNase U2 at pH 3.5 cleaves A-N bonds more efficiently than at pH 5.0.

Base Sequence↗
PubMedDate not supplied

Enzymatic RNA synthesis and RNase P. Evolutionary aspects.

TransferRNA recognition was used as leit-motiv in the illustration of possible links between a hypothetical primordial RNA world and the contemporary DNA world. In an RNA world, 'proto-tRNA' could have functioned as replication origin and as primitive telomere. Possibly, this primitive structure is preserved in a 'universal substrate' for modern tRNA-specific enzymes. The combination of acceptor stem and T arm (plus a linker) was finally revealed as sufficient for the recognition by prokaryotic and eukaryotic RNase P, as well as other tRNA enzymes. In modern life forms, a tRNA-like element in viral RNAs still serves as replication origin, and furthermore, the recognition of similar structures as cryptic promoters is universally conserved for template-dependent RNA polymerases. Another common property of modern polymerases is their high, but clearly limited and condition-dependent substrate specificity. Very likely, also substrate recognition by primitive polymerases was not more stringent, and this lead to the occurrence of mixed nucleic acids as intermediates in the transition of genomic RNA to contemporary genomic DNA.

Biological Evolution↗
PubMedDate not supplied

The RNA required in the first step of chlorophyll biosynthesis is a chloroplast glutamate tRNA.

A molecule of chlorophyll is synthesized from eight molecules of delta-aminolevulinate (DALA), the universal precursor of porphyrins. The light-regulated conversion of glutamate to delta-aminolevulinate in the stroma of greening plastids involves the reduction of glutamate to glutamate-1-semialdehyde and its subsequent transamination. The components performing this conversion have been isolated from barley and Chlamydomonas and separated into three fractions by serial affinity chromatography on Blue Sepharose and haem- or chlorophyllin-Sepharose. The complete reaction can be performed in vitro in a reconstituted assay by combining all three fractions. An RNA is the essential component of the chlorophyllin-Sepharose-bound fraction. By nucleotide sequence analysis, we have now identified this RNA as a chloroplast glutamate acceptor RNA. Glutamate attached by an aminoacyl bond to the 3'-terminal adenosine of this RNA is a substrate for the enzyme(s) which perform the subsequent reactions. This reaction represents a novel role for transfer RNA: participation in the metabolic conversion of its cognate amino acid into another metabolite of low relative molecular mass which subsequently is not used in peptide bond synthesis.

Aminolevulinic Acid↗