PubMed Health⌕ Search

Biomedical subjects

G Löber

Publications and source records attributed to G Löber.

49 records · Page 3Linked to original sources
PubMedDate not supplied

DNA binding properties of minor groove binders and their influence on the topoisomerase II cleavage reaction.

We present titrations of the human delta beta-globin gene region with DNA minor groove binders netropsin, bisnetropsin, distamycin, chromomycin and four bis-quaternary ammonium compounds in the presence of calf thymus topoisomerase II and DNase I. With increasing ligand concentration, stimulation and inhibition of enzyme activity were detected and quantitatively evaluated. Additionally we show a second type of stimulation, the appearance of strong new topoisomerase II cleavage sites at high ligand concentrations. The specific binding sites of the minor groove binders of the DNA sequence and their microscopic binding constants were determined from DNase I footprints. A binding mechanism for minor groove binders is proposed in order to explain these results especially when ligand concentration is increased.

Animals↗
PubMedDate not supplied

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Cisplatin↗
PubMedDate not supplied

Sequence specific modulation of DNA restriction enzyme cleavage by minor groove binders.

The inhibition of restriction endonuclease cleavage by a series of bisquaternary ammonium derivatives (BQA-derivatives) which bind to the minor groove of DNA has been studied. The derivatives considered included six sequence-selective binders (SN 6570, SN 6999, SN 6050, SN 6132, SN 6131 and SN 18071) and four non-specific binders (SN 6113, SN 5754, SN 6324 and SN 4094) and can be distinguished by their activity on restriction endonucleases. Digestion experiments with pUC19 DNA were monitored electrophoretically using the transition of the covalently closed circular (ccc) DNA into the linear double stranded (lds) one. Only the sequence-specific binders inhibit the cleavage activity of restriction endonucleases EcoRI, SspI and DraI with four and six dAdT-base pairs within their restriction sites, while the activity of SalI and BamHI with less than four dAdT-sequences was unaffected. In contrast, the non-specific binding ligands were incapable of suppressing enzyme digestion. The inhibition of the restriction endonuclease PvuII indicates that ligand binding in close vicinity to the cleavage sites is also involved in the enzyme inhibition. The dAdT-content in proximity to the palindromic sequences of three DraI cutting sites in pUC19 DNA explains why the derivative SN 6053 protects these sequences in different manners. Gel shift experiments indicated that BQA-derivatives inhibit the DNA-enzyme complex formation if the ligand was added to the DNA before the enzyme. In contrast, complex formation between DNA and enzyme remained unchanged when the enzyme was added first.

Deoxyribonucleases, Type II Site-Specific↗
PubMedDate not supplied

Cationic anticancer drugs and their modes of action.

This report focuses on two groups of cationic cancerostatics, anthracycline antibiotics and 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone (ambazone), lining up biophysical and biochemical effects on the level of membranes and membrane constituents. The interaction of both drugs with multilamellar liposomes consisting of phosphatidylcholine used as a simple model membrane system could be ensured by means of steady state and nanosecond time-resolved fluorometric investigations. The biochemical effect on membranes is underlined by the inhibition of the neuraminidase activity of the Sendai virus, modification of the CAMP phosphodiesterase activity of leukemia L 1210 cells of mice and reduction of the lymphocyte blast transformation.

3',5'-Cyclic-AMP Phosphodiesterases↗
PubMedDate not supplied

The effect of violamycin BI on different biological systems. Note I. The action of violamycin BI on cell cultures infected or not with herpes simplex virus type 1.

The effect of violamycin BI (VBI) was investigated in different cell substrates, infected or not with herpes simplex virus type 1 (HSV-1), strains VR3 and Rapp-1. The cytotoxic dose of VBI was established in calf kidney and human embryo cell cultures. Low drug concentrations induced moderate cytotoxic changes, allowing the study of the cells for 4-6 days. The action of VBI on HSV-1 was evident mostly in the early phases of the virus multiplication cycle. The antiviral effect of VBI was due both to the direct action of the drug on HSV and to its interaction with the nucleic acids of the host cells supporting HSV multiplication in their nuclei.

Aminoglycosides↗
PubMedDate not supplied

Effect of biologically active compounds (anthracyclines and ethidium bromide) on some membrane-mediated processes in the course of viral infection. Investigations on a prokaryotic (bacteriophage-bacterium) system.

Anthracycline antibiotics--violamycin B1 and adriamycin--have an obvious effect on the efficiency of phage lambda L47.1 DNA transfection into E. coli Q358 cells. Treatment with anthracyclines of either phage DNA or bacterial cells results in a marked decrease in the number of transfectants per microgram DNA. On the other hand, adsorption of phage lambda gt WES to E. coli LE392 is considerably modified by exposure to anthracyclines of either the phage or the host cells.

Adsorption↗
PubMedDate not supplied

Secretion of neutral and acid DNases in cultivated human lymphocytes after incubation with DNA; possible consequences for inhalation anesthesia.

After incubation with DNA human lymphocytes release neutral and acid DNase activities into the culture medium; the release depends on DNA concentration and time of cultivation. The electrophoretic mobility of the released neutral DNase activity is in accordance with DNase I and the electrophoretic mobility of the released acid DNase activity with DNase II. The released DNase activities do not originate from dead cells and are not influenced by blast cell formation. The anesthetic halothane can inhibit the released neutral and acid DNase activities. Inhalation anesthesia can possibly disturb the correlation between DNA and DNases in human blood.

Anesthesia, Inhalation↗
PubMedDate not supplied

Specific targeting of human papillomavirus type 16 E7 oncogene with triple-helix forming purine oligodeoxyribonucleotides.

Molecular mechanical calculations (computer modelling), optical DNA melting experiments and co-migration assay were used to assess stable helix formation at homopurine--homopyrimidine-rich target sites present in the human papillomavirus type 16 E7 oncogene (positions 656-673 on the genome map). The target sequence, either present in the E7 oncogene obtained by PCR technique or prepared from oligodeoxyribonucleotides (ODNs), can be specifically recognised by different 17-merpurine ODNs designed to form antiparallel or parallel triple helices. These in vitro experiments realised with rather long purine ODNs having a high degree of specificity open the way for in vivo tests focused on E7 oncogene targeting and suppression.

Base Sequence↗