Biomedical subjects

G Manzini

Publications and source records attributed to G Manzini.

At least 19 recordsLinked to original sources

PubMed1996

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

3T3 Cells↗

PubMed1996

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.

DNA, Single-Stranded↗

PubMed1996

Guanine-rich oligonucleotides targeted to a critical R . Y site located in the Ki-ras promoter. The effect of competing self-structures on triplex formation.

The promoter of the murine Ki-ras proto-oncogene contains a (C+G)-rich homopurine . homopyrimidine (R . Y) sequence that is essential for transcription activity. We have designed two G-rich oligonucleotides, d(TGGGTGGGTGGTTGGGTGGG) (20GT) and d(AGGGAGGGAGGAAGGGAGGG) (20AG), that have the potential to bind the critical Ki-ras sequence via triplex-helix formation. Band-shift experiments have shown that 20GT binds the Ki-ras R . Y duplex with a delta G value of -40 +/- 5 kJ/mol, while 20AG appeared to have a lower affinity under the experimental conditions adopted: 50 mM Tris/HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2, 25 degrees C. In the absence of Mg2+, 20GT did not bind to the Ki-ras R . Y target, while 20AG exhibited the same affinity observed in the magnesium-containing buffer. To gain insight into the solution properties of 20GT and 20AG, we have performed several experiments including polyacrylamide gel electrophoresis (PAGE), hydroxyapatite chromatography, ultraviolet absorption melting and circular dichroism (CD). We found that 20AG rapidly self-associates into presumably a duplex, even at low concentration (< 1 microM), while 20GT forms aggregates slowly, a process favoured by high oligonucleotide concentrations (> 25 microM). The critical Ki-ras sequence was inserted in Bluescript KS+, downstream from the T7 promoter, to investigate to what extent 20AG and 20GT, which are directed against the R . Y target, are able to inhibit T7 RNA polymerase transcription, under near-physiological conditions. Transcription experiments conducted in vitro at pH 7.4 have shown that oligonucleotide 20GT produced a remarkable repression of T7 RNA polymerase activity in the concentration range (10-25 microM), whereas 20AG had little effect on transcription. In conclusion, the results of this work together with other data reported in the literature [Olivas, W. M. & Maher, L. J. III (1995) Biochemistry 34, 278-284; Noonberg, S. B., François, J.-C., Garestier, T. & Hélène, C. (1995) Nucleic Acids Res. 23, 1956-1963], demonstrate that G-rich oligonucleotides, in particular (G,A)-sequences, may raise problems for in vivo application due to self-aggregation.

Absorption↗

PubMed1994

Inhibition of T7 RNA polymerase transcription by phosphate and phosphorothioate triplex-forming oligonucleotides targeted to a R.Y site downstream from the promoter.

The effect of triplex-forming oligonucleotides (TFO) on the transcription activity of T7 RNA polymerase has been investigated by an in vitro assay. The TFOs, either containing only phosphate (PO2) or phosphate and phosphorothioate (POS) internucleotide linkages, were targeted to a 30-bp homopurine. homopyrimidine (R.Y) site cloned in plasmid Bluescript KS+ about four helical turns downstream from the T7 RNA promoter. Band-shift and ultraviolet absorption melting experiments showed that the designed pyrimidine PO2 and POS TFOs form stable triple-helical complexes with the R.Y target duplex (the delta GTFO values of triplex formation vary from -42 to -63 kJ/mol). The triple-helical complexes resulting from POS oligonucleotides were less stable (by 4-12 kJ/mol) than those obtained with PO2 analogues, the magnitude of destabilization being dependent on the number of POS groups present in the third strand. The designed TFOs were shown to efficiently repress bacteriophage T7 RNA polymerase transcription under different experimental conditions. The repression depended on pH, TFO concentration and temperature. When the TFO/template ratio was fixed to 100, a strong repressive effect was observed with normal and phosphorothioate pyrimidine TFOs, also under physiological conditions. In contrast, a purine-rich oligonucleotide containing 44% of guanine residues promoted only a weak transcription inhibition, even at a TFO/template ratio as high as 750. Both PO2- and POS-containing pyrimidine TFOs produced their strong repressive effect on T7 RNA polymerase transcription even when they were added to the reaction mixture simultaneously with the polymerase. A mechanism of transcription repression is discussed. The data reported in this paper are useful for designing oligonucleotides acting as artificial repressors in the antigene strategy and indicate that the R.Y target need not to be precisely confined to the promoter.

Base Sequence↗

PubMed1994

Evidence for intramolecularly folded i-DNA structures in biologically relevant CCC-repeat sequences.

The structural behaviour of repetitive cytosine DNA is examined in the oligodeoxynucleotide sequences of (CCCTAA)3CCCT (HTC4), GC(TCCC)3TCCT(TCCC)3 (KRC6) and the methylated (CCCT)3TCCT(CCCT)3C (KRM6) by circular dichroism (CD), gel electrophoresis (PAGE), and ultra violet (UV) absorbance studies. All the three sequences exhibit a pH-induced cooperative structural transition as monitored by CD. An intense positive CD band around 285 nm develops on lowering the pH from 8 to slightly acidic condition, indicative of the formation of base pairs between protonated cytosines. The oligomers are found to melt in a fully reversible and cooperative fashion, with a melting temperature (Tm) of around 50 degrees C at pH 5.5. The melting temperatures are independent from DNA concentration, indicative of an intramolecular process involved in the structural formation. PAGE experiments performed with 32P-labeled samples as well as with normal staining procedures show a predominantly single band migration for all the three oligomers suggestive of a unimolecular structure. From pH titrations the number of protons required for generating the structures formed by HTC4, KRC6 and KRM6 results to be around six. These findings strongly suggest that all the three sequences adopt an intramolecular i-motif structure. The demonstration of i-motif structure for KRC6, a critical functional stretch of the c-ki-ras promoter proto-oncogene, besides the human telomeric sequence HTC4, may be suggestive of larger significance in the functioning of DNA.

Base Sequence↗

PubMed1994

Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides targeted to genomic DNA in antigene strategy.

Base Sequence↗

PubMed1994

Effect of 5-methylcytosine on the structure and stability of DNA. Formation of triple-stranded concatenamers by overlapping oligonucleotides.

A triple helix can be formed upon binding of a pyrimidine oligonucleotide to the major groove of a homopurine-homopyrimidine (R.Y) double-stranded DNA target site. Here, we report that this reaction can be influenced by base methylation. The pyrimidine strand 5'-TmCTmCTmCTmCTTmCT (mY12), whose cytosine residues are methylated at C5, does not bind the duplex 5'-AGAGAGAGAAGA.3'-TCTCTCTCTTCT (R12.Y12) to yield a 12-triad triplex, as would be expected from these DNA sequences. Rather, a complex of overlapping oligonucleotides, which we define concatenamer, is formed. The concatenamer is clearly evidenced by polyacrylamide gel electrophoresis (PAGE) since it migrates with a smeared band of very low mobility. The stoichiometry of the concatenamer, determined by both UV mixing curves and electrophoresis, is surprisingly found to be (R12.2mY12)n, thus showing that the unmethylated Y12 strand is excluded from the complex. Denaturation experiments performed by ultraviolet absorbance (UV) and differential scanning calorimetry (DSC) show that the concatenamers melt with a single and highly cooperative transition whose Tm strongly depends on pH. Overall, the data point to the conclusion that the concatenamers are in triple helix, where the methylated mY12 strand is engaged in both Watson-Crick and Hoogsteen base pairings, thus displacing the Y12 strand from the R12.Y12 duplex. A possible mechanism of concatenamer formation is proposed. The results presented in this paper show that 5-methylcytosine brings about a strong stabilizing effect on both double and triple DNA helices, and that pyrimidine oligonucleotides containing 5-methylcytosine can displace from R.Y duplexes the analogous non-methylated strand. The advantage of using methylated oligonucleotides in antisense technology is discussed.

5-Methylcytosine↗

PubMed1993

L-DNAs as potential antimessenger oligonucleotides: a reassessment.

Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression.

Base Sequence↗

PubMed1993

Sequence-specific DNA-triplex formation at imperfect homopurine-homopyrimidine sequences within a DNA plasmid.

The ability of pyrimidine-rich and purine-rich oligodeoxynucleotides to form stable triple-helical structures with imperfect R.Y target sites, containing C interruptions in the purine strand (CG inversions) and located within Bluescript KS+, a plasmid of 2959 bp, has been investigated by electrophoresis, ultraviolet absorbance and cleavage-protection experiments. First, we synthesized double-stranded oligonucleotides corresponding to the plasmid sites and studied their interaction with oligopyrimidines which oppose either G or T to CG inversions. The resulting imperfect DNA triplexes were detected by gel-mobility shift. Their melting profiles were found to be biphasic, and the triplex-to-duplex plus single-strand transition was affected by hysteresis. The 21-nucleotide triplex containing three GC.G mismatched triads had tm = 45 degrees C, while the same triplex, but with three GC.T triads, had tm = 31 degrees C. Moreover, replacing C with 5-methylcytosine in the third strand resulted in a significant stabilization of the defective triplex, tm = 49 degrees C. The potential of the 21-nucleotide oligopyrimidines to recognize and bind in a sequence-specific manner to imperfect R.Y sequences in Bluescript KS+ has been investigated by means of a restriction-endonuclease-protection assay, taking advantage of the fact that one R.Y sequence of Bluescript KS+ was partially overlapped with a HaeII site. Effective endonuclease inhibition was observed with oligopyrimidines opposing G-to-GC inversions, at 10-50 microM. By contrast, the oligopyrimidine opposing T-to-CG inversions did not exhibit any interference with endonuclease activity in our standard conditions. Finally, we have tested the ability of purine-rich strands to bind the R.Y sites of Bluescript KS+. A very weak cleavage protection was observed by using an oligomer (130 microM) with a polarity antiparallel to the purine strand of the target site. The resulting Y.R.R triplex was stabilized by CG.G (GC.G) and TA.A base triplets. This triplex denatures with a low cooperative melting profile suggesting the absence of strong interactions between the third strand and the target site.

Base Sequence↗

PubMed1992

Charge effect in the interaction of doxorubicin and derivatives with polydeoxynucleotides.

The equilibrium interaction of doxorubicin and its N-acetyl derivative with a series of purine-pyrimidine alternating polydeoxynucleotides has been studied through spectrofluorometry to assess the relevance of the electrostatic contribution to DNA intercalation. The results have shown that: (a) the suppression of the positive charge on the aminosugar has: (I) a profound negative effect on the free energy of intercalation, as expected, and (II) a negligible influence on the base specificity, which supports the notion of an essentially electrostatic effect of N-acetylation on intercalation; (b) a reasonably good accord with the demands of a polyelectrolytic model, due to Friedman and Manning, is found.

DNA↗

PubMed1991

Effect of 5-methylcytosine on the stability of triple-stranded DNA--a thermodynamic study.

We have previously shown that the pyrimidine oligonucleotide 5'CTTCCTCCTCT (Y11) recognizes the double-helical stem of hairpin 5'GAAGGAGGAGA-T4-TCTCCTCCTTC (h26) by triple-helix formation (1). In this paper, we report the effect on triplex formation of substituting the cytosine residues of Y11 with 5-methylcytosines (5meY11). In addition, we have studied the thermodynamics of the interaction between h26 and 5meY11. The results can be summarised as follows: (i) gel electrophoresis shows that at T = 5 degrees C and pH 5, both Y11 and 5meY11 form DNA triple helices with h26, whereas at pH 6.8 only the methylated strand binds to h26; (ii) pH-stability curves of the DNA triplexes formed from h26 + Y11 and h26 + 5meY11 show that Y11 and 5meY11 are semi-protonated at pH 5.7 and 6.7, respectively. Thus, it is concluded that cytosine methylation expands the pH range compatible with triplex formation by one pH unit; (iii) as the unmethylated triplex (h26:Y11), the methylated one (h26:5meY11) denatures in a biphasic manner, in which the low temperature transition results from the dissociation of 5meY11 from h26. The Tm of the triplex to h26 plus 5meY11 transition is strongly enhanced (about 10 degrees C) by cytosine methylation. A van 't Hoff analysis of denaturation curves is presented; (iv) DSC experiments show that triplex formation between 5meY11 and h26 is characterized by delta H = -237 +/- 25 kJ/mol and delta S = -758 +/- 75 J/Kmol, corresponding to an average delta H of -21 kJ/mol and delta S of -69 J/Kmol per Hoogsteen base pair; (v) the thermodynamic analysis indicates that the extra stability imparted to the triplex by methylcytosine is entropic in origin.

5-Methylcytosine↗

PubMed1991

DNA hairpin loops in solution. Correlation between primary structure, thermostability and reactivity with single-strand-specific nuclease from mung bean.

Hairpin structures formed by seven DNA inverted repeats have been studied by PAGE, UV(CD)-spectroscopy and nuclease cleavage. The hairpins consisted of (CG)3 stems and loops of 2, 3 and 4 residues. Thermal stabilities (Tm) have been determined in low and high ionic strength buffers, where the hairpins were structured in the B- and Z-DNA form respectively. The thermodynamic parameters of hairpin formation have been obtained by a two-state analysis of the hairpin-coil transitions. It is found that, on increasing the number of bases in the loop from 2 to 3 and 4, the Tms of the B-hairpins decrease, whereas the Tms of the same hairpins in the Z-form increase. This confirms previous evidence (1,2) that in a hairpin molecule the size and structure of the loop are modulated by the conformation of the helical stem. Moreover, B-hairpins with loops comprising 2, 3 and 4 bases have been digested with the single-strand-specific nuclease from mung bean. In our experimental conditions (0 degrees C) the nuclease preferentially cleaves the unbonded nucleotides of the loops. However, the rates of loop hydrolysis, which roughly follow a first-order kinetics, markedly depend on the size of the loop. At a ratio of 3 enzyme units/micrograms DNA, the half-lives of hairpins which are expected to form loops of 4, 3 and 2 residues are 90, 145 and 440 minutes respectively. Thermostability and enzymatic digestion data suggest that two-membered loops can be formed in B-hairpins but not in Z-hairpins.

Base Sequence↗

PubMed1990

Spectroscopic and calorimetric investigation on the DNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) at acidic pH.

The equimolar mixture of d(CTCTTCTTTCTTTTCTTTCTTCTC) (dY24) and d(GAGAAGAAAGA) (dR11) [designated (dY24).(dR11)], forms at pH = 5 a DNA triplex, which mimicks the H-DNA structure. The DNA triplex was identified by the following criteria: (i) dY24 and dR11 co-migrate in a poly-acrylamide gel, with a mobility and a retardation coefficient comparable to those observed for an 11-triad DNA triplex, previously characterized in our laboratories (1); (ii) the intercalator ethidium bromide shows a poor affinity for (dR11).(dY24) at pH = 5, and a high affinity at pH = 8; (iii) the (dR11).(dY24) mixture is not a substrate for DNase I at pH = 5; (iv) the CD spectrum of (dR11).(dY24), at pH = 5, is consistent with those previously reported for triple-stranded DNA. The (dR11).(dY24) mixture exhibits a thermally induced co-operative transition, which appears to be monophasic, reversible and concentration dependent. This transition is attributed to the disruption of the DNA triplex into single strands. The enthalpy change of the triplex-coil transition was measured by DSC (delta Hcal = 129 +/- 6 kcal/mol) and, assuming a two-state model, by analysis of UV-denaturation curves (average of two methods delta HUV = 137 +/- 13 kcal/mol). Subtracting from delta Hcal of triplex formation the contributions due to the Watson-Crick helix and to the protonation of the C-residues, we found that each pyrimidine binding into the major groove of the duplex, through a Hoogsteen base pair, is accompanied by an average delta H = -5.8 +/- 0.6 kcal/mol. The effect on the stability of the (dR11).(dY24) triplex due to the substitution of a T:A:T triad with a T:T:T one was also investigated.

Base Sequence↗

PubMed1990

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Base Sequence↗

PubMed1990

[Spontaneous esophageal rupture or Boerhaave's syndrome. Presentation of a case].

A case of spontaneous oesophageal rupture or Boerhaave syndrome is described. The absence of the typical initial vomiting together with a clinical picture that successively indicated repeated myocardial infarction, pancreatitis and pulmonary abscess delayed diagnosis by 4 days, after which emergency thoracotomy, performed on the identification of extravisceral overflow by contrast radiography using a water-soluble medium, revealed necrotic inflammation of the oesophagus, mediastinum and left lung that was so severe that only thoracic drainage was possible. After an initial improvement the patient died of septic shock on the 16th postoperative day.

Aged↗

PubMed1989

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Animals↗

PubMed1989

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition.

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Base Composition↗

PubMed1989

The left-handed Z-DNA conformation in oligodeoxynucleotides containing different amounts of AT base pairs: a far UV circular dichroism study.

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long- (220-300 nm) and short-wavelength (185-220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows: a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%; b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required; c) (AC)n and (GT)n containing oligonucleotides do undergo the B to Z transition in solution; d) a millimolar quantity of Ni2+ concomitant with 5 M NaClO4 is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.

Adenine↗