PubMed Health⌕ Search

Biomedical subjects

G Milman

Publications and source records attributed to G Milman.

At least 19 recordsLinked to original sources
PubMed1995

Neutralization of primary HIV-1 isolates by anti-envelope monoclonal antibodies.

OBJECTIVE: To evaluate human monoclonal antibodies (MAb) for neutralizing activity against primary HIV-1 isolates in peripheral blood mononuclear cells. DESIGN: Neutralization activity data were obtained from 11 laboratories on a coded panel consisting of six human MAb to HIV envelope V3, CD4-binding region or gp41. Hyperimmune globulin against HIV-1 and normal human immunoglobulin G were supplied as controls. Each laboratory received pre-titered virus for use in the studies. METHODS: Each laboratory measured neutralization of the MAb against laboratory strain HIVMN, genomic clone HIVJR-CSF, two subtype B and one subtype D primary isolates. RESULTS: The titers of the centrally supplied virus stocks as determined by re-titration or back-titration varied among laboratories and were generally 10-100-fold less than provided. The neutralizing activity of each MAb varied by as much as a 1000-fold among laboratories. These differences may result from varying sensitivity in neutralization assay protocols and the differing susceptibility of primary cells to infection with HIV-1. CONCLUSIONS: To consolidate the data from multiple laboratories, the neutralization titers were compared by classifying antibodies as neutralizing if the antibody concentration for 50% virus inhibition was < or = 10 micrograms/ml. By this criterion, the CD4-binding region and gp41 MAb neutralized all four subtype B viruses and the subtype D isolate in a few of the laboratories. The V3 MAb neutralized only HIVMN and the closely related HIVJR-CSF viruses.

Antibodies, Monoclonal↗
PubMed1994

Mechanisms of HIV/SIV mucosal transmission.

The Division of AIDS (DAIDS), National Institute of Allergy and Infectious Diseases (NIAID), organized a Workshop on HIV/SIV Pathogenesis and Mucosal Transmission on March 14-17, 1994, attended by over 300 participants. The purpose of the workshop was to foster research in the areas of HIV pathogenesis, mucosal transmission, and host factors modulating HIV infection and disease. This article summarizes workshop presentations that focused on mechanisms of HIV or SIV mucosal transmission. The following are highlights from the workshop. The epidemiological data indicating a low probability of infection from a single sexual exposure are consistent with observations that infectious cell-free or cell-associated HIV could be isolated from only 10-57% of semen samples, and that high levels of SIV are required for infection by a mucosal route. Several lines of circumstantial evidence suggest that an important property of a transmitted HIV or SIV is the ability to infect macrophages. A potential mechanism for cell-associated mucosal transmission is provided by the observations that CD4-negative epithelial cells in culture are efficiently infected by direct contact with HIV-infected T cells, and that HIV-infected epithelial cells are observed in vivo. Cell-free HIV virions contain partial reverse transcripts of viral RNA into DNA, and conditions that promote DNA reverse transcripts, such as incubation in seminal fluid, increase viral infectivity. Finally, evidence is accumulating that transient or abortive infection with short-term recovery of infectious virus in blood can occur in the absence of seroconversion.

Animals↗
PubMed1994

HIV-mediated defects in immune regulation.

The Division of AIDS (DAIDS), National Institute of Allergy and Infectious Diseases (NIAID), sponsored a Workshop on HIV-Mediated Defects in Immune Regulation on September 29-30, 1993. Workshop participants included investigators in basic research of immune regulation, animal models of HIV disease, HIV epidemiology, and HIV clinical research and treatment. The purpose of the workshop was to describe and evaluate biological mechanisms of HIV-mediated immune deficiency other than direct killing of infected CD4+ cells. The workshop focused on HIV-mediated dysfunction in signal transduction and in T cell development and maturation. Mechanisms by which HIV has been proposed to influence signal transduction include gp120 ligation to CD4, HIV superantigen(s), and HIV-mediated perturbations in signal pathway components (e.g., receptors, kinases, phosphatases, cytokines, and cyclins). As a result of signal dysfunction, cells may fail to respond to foreign antigens (anergy) or become predisposed to enter suicide pathways, otherwise known as programmed cell death or apoptosis. Programmed cell death is a normal immune regulatory mechanism that is activated to prevent anti-self responses and also to delete expanded but no longer needed cell populations. In the immune system, new cells are constantly produced from stem cells to replace those that die from age, pathological response, or programmed cell death. Dysfunction in these new cells may occur if HIV causes changes in the structural environment of the thymus and lymph nodes, or in cytokine signals.

Animals↗
PubMed1994

Evaluation of monoclonal antibodies to HIV-1 envelope by neutralization and binding assays: an international collaboration.

OBJECTIVE: To characterize a purified panel of monoclonal antibodies (MAb) to epitopes in HIV-1 envelope V3, CD4-binding region, C4 and gp41. DESIGN: Neutralization and/or binding activity data were obtained from 21 laboratories on a coded panel consisting of seven human MAb, seven mouse MAb, recombinant human CD4 immunoadhesin [CD4-immunoglobulin G (IgG)], normal human and normal murine Ig. METHODS: Laboratories performed a variety of neutralization assays and antigen binding assays with HIVIIIB, HIVMN and other laboratory strains of HIV-1. RESULTS: For a single MAb, there was up to a 10(3) range of neutralizing antibody titers between laboratories. The range in titers appeared to depend on the sensitivity of the neutralization assay. Two methods were used to consolidate the data from all laboratories, the geometric mean titer (GMT) and the median neutralizing titer (MNT). The panel of MAb were also analyzed by a variety of assays that measure binding activity to native or denatured epitopes. The relative binding activity of the MAb did not appear to correlate with neutralizing activity. CONCLUSION: Neutralization results from any single laboratory did not correlate with the collective data. The relative potency (rank order) of the MAb in the panel were equivalent when determined by GMT or MNT. These values may be useful to individual laboratories for estimating the sensitivity of their neutralization assays. The study also identified potential reference reagents with which neutralizing activity could be compared.

Amino Acid Sequence↗
PubMed1993

International collaboration comparing neutralization and binding assays for monoclonal antibodies to simian immunodeficiency virus.

Thirteen laboratories characterized a coded panel of 10 MAbs to SIVmac251 envelope protein in a collaboration organized by the National Institute of Allergy and Infectious Diseases (NIAID). The MAbs were examined against SIV isolates in neutralization and radioimmune precipitation, immunoblot, enzyme-linked immunosorbent, and radioimmune assays. Although laboratories employed diverse neutralization assays that varied in sensitivity there was agreement on the relative ability of the MAbs to neutralize SIVmac251. Additionally, even though the quantity of any single MAb required to neutralize SIVmac251 varied between laboratories, there was agreement on the rank-order strength fo the five neutralizing MAbs. Based on the data from this study, the MAbs were classified according to their neutralization potential as high efficiency (MAb concentration, < 5 micrograms/ml), low efficiency (MAb concentration, 5-100 micrograms/ml), or nonneutralizing (MAb concentration, > 100 micrograms/ml). The MAbs could be assigned to four serological groups based on ability to cross-neutralize and bind different SIV isolates. The distinction between groups I, II, and III were based on the limited neutralization data obtained with the sooty mangabey isolate.

Animals↗
PubMed1992

Comparison of three nonradioisotopic polymerase chain reaction-based methods for detection of human immunodeficiency virus type 1.

Three nonradioisotopic polymerase chain reaction (PCR)-based detection techniques were evaluated for sensitivity and specificity in detecting human immunodeficiency virus type 1 (HIV-1) proviral DNA in peripheral blood mononuclear cells. The Roche prototype HIV-1 PCR assay, the Du Pont enzyme-linked oligonucleotide sandwich assay (ELOSA), and the Gen-Probe hybridization protection assay (HPA) were compared with a standard radioisotopic oligonucleotide solution hybridization (OSH) technique. A panel of 111 well-characterized clinical samples that included peripheral blood mononuclear cells from 48 healthy, low-risk, HIV-1 antibody-negative subjects, 24 antibody-positive subjects with stable CD4 counts of less than 200/mm3, and 39 antibody-positive subjects with stable CD4 counts of greater than 800/mm3 were studied. Each method demonstrated good specificity, ranging between 96 and 100%; those of the OSH and ELOSA (Du Pont) were 100%, those of the HPA (Gen-Probe) were 100% with one probe and 96% with the other probe, and that of the HIV-1 PCR assay (Roche) was 96%. Sensitivities ranged from 96 to 100% for the low-CD4-count group, with the OSH, the HIV-1 PCR assay (Roche), and the HPA (Gen-Probe) all attaining a sensitivity of 100%. For the high-CD4-count group, sensitivities ranged from 69 to 97%, with the OSH attaining a sensitivity of 97% and the HPA attaining sensitivities of 97% with one probe and 95% with the other probe. These data indicate that the nonradioisotopic techniques are sensitive and specific for the detection of HIV-1 proviral DNA in clinical samples.

Base Sequence↗
PubMed1991

Evaluation of monoclonal antibodies to HIV-1 by neutralization and serological assays: an international collaboration. Collaborating Investigators.

In a National Institutes of Health (NIH)/World Health Organization (WHO)-sponsored collaboration, 26 laboratories characterized a coded panel of monoclonal antibodies (MAb) to HIV-1 envelope protein. The MAb were evaluated by serological [radioimmunoprecipitation, immunoblot, enzyme-linked immunosorbent assay (ELISA) and peptide mapping] and neutralization assays. Although laboratories used diverse neutralization assays that vary considerably in sensitivity, qualitatively similar data were obtained. The MAb were classified into three neutralization specificities: type-specific for MN and SF2, type-specific for IIIB, and group-specific for MN, SF2, and IIIB. The group-specific MAb displayed much lower neutralizing titers than the type-specific MAb. The specificity of MAb for neutralization was greater than for serological recognition of gp120 protein or peptide epitopes. Some MAb that bound to the same or closely overlapping linear epitopes had very different neutralization properties. The distinction between serological recognition and neutralization may result from differences in affinity of the MAb or may indicate that MAb can neutralize by interactions at a site distinct from the antibody binding site.

Amino Acid Sequence↗
PubMed1989

High-resolution footprints of the DNA-binding domain of Epstein-Barr virus nuclear antigen 1.

The DNA-binding domain of Epstein-Barr virus nuclear antigen 1 was found by hydroxyl radical footprinting to protect backbone positions on one side of its DNA-binding site. The guanines contacted in the major groove by the DNA-binding domain of Epstein-Barr virus nuclear antigen 1 were identified by methylation protection. No difference was found in the interaction of the DNA-binding domain of Epstein-Barr virus nuclear antigen 1 with tandemly repeated and overlapping binding sites.

Antigens, Viral↗
PubMed1988

Epstein-Barr virus serology in the control of nasopharyngeal carcinoma.

Epstein-Barr virus (EBV) is suspected as being etiologically related to nasopharyngeal carcinoma (NPC). Antibodies to EBV antigens have been used in the early detection of NPC and serologic assays are being utilized in the mass screening of high risk populations. While areas of potential application to disease control, such as therapy, are still in the developmental phase, EBV serology has been reported to be of value in the detection of early relapse. Since the data from a series of studies provide conflicting results, however, in this report we review the current information regarding detection of early relapse and describe specific areas that require particular attention if the role of EBV serology in this aspect of NPC control is to be well defined.

Antigens, Viral↗
PubMed1987

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.

Antigens, Viral↗
PubMed1986

In situ autoradiographic detection of folylpolyglutamate synthetase activity.

The enzyme folylpolyglutamate synthetase (FPGS) catalyzes the conversion of folate (pteroylmonoglutamate) to the polyglutamate forms (pteroylpolyglutamates) that are required for folate retention by mammalian cells. A rapid in situ autoradiographic assay for FPGS was developed which is based on the folate cofactor requirement of thymidylate synthase. Chinese hamster AUX B1 mutant cells lack FPGS activity and are unable to accumulate folate. As a result, the conversion of [6-3H]deoxyuridine to thymidine via the thymidylate synthase reaction is impaired in AUX B1 cells and no detectable label is incorporated into DNA. In contrast, FPGS in wild-type Chinese hamster CHO cells causes folate retention and enables the incorporation of [6-3H]deoxyuridine into DNA. Incorporation may be detected by autoradiography of monolayer cultures or of colonies replica plated onto polyester discs. Introduction of Escherichia coli FPGS into AUX B1 cells restores the activity of the thymidylate synthase pathway and demonstrates that the E. coli FPGS enzyme can provide pteroylpolyglutamates which function in mammalian cells.

Animals↗
PubMed1986

Characterization of human folylpolyglutamate synthetase expressed in Chinese hamster ovary cells.

Chinese hamster AUX B1 cells lack the enzyme folylpolyglutamate synthetase (FPGS) responsible for adding polyglutamates to folic acid. The human gene for FPGS was introduced into AUX B1 cells by cotransfection with human genomic DNA and either pSV2neo or pSV2gpt plasmid DNA. Cells were coselected for FPGS expression by growth in the absence of glycine, adenosine, and thymidine, and for drug resistance by growth in geneticin or mycophenolic acid. The presence of human enzyme in transfected cells was identified by relative enzyme activity determinations with ATP or dATP as substrates. The human HeLa cell enzyme displayed a 50% higher activity with dATP, and the hamster enzyme showed a 50% higher activity with ATP. Hamster and human enzymes also differed in the chain length of polyglutamates on cellular folate. Only monoglutamates were detected in AUX B1 cells, while wild-type hamster cells had predominantly hexa- and heptaglutamates, and human HeLa cells had predominantly hepta- and octaglutamates. Transformants with FPGS activity that showed a human enzyme preference for dATP also had folate polyglutamate chain lengths characteristic of the human enzyme.

Animals↗
PubMed1986

Enzyme-linked immunosorbent assay of antibodies to Epstein-Barr virus nuclear and early antigens in patients with infectious mononucleosis and nasopharyngeal carcinoma.

A sensitive enzyme-linked immunosorbent assay was used to measure titers of IgG antibodies against bacterially synthesized Epstein-Barr virus nuclear antigen and early antigen in sera from 100 healthy North Americans, 40 North American patients with infectious mononucleosis, and 48 Asian patients with nasopharyngeal carcinoma. All healthy persons previously infected with Epstein-Barr virus had antibodies to nuclear antigen, and 70% had very low but detectable antibody titers to early antigen. In contrast, patients with mononucleosis had nondetectable or very low levels of antibodies to nuclear antigen and high antibody levels to early antigen. High levels of antibody to early antigen also were seen in patients with nasopharyngeal carcinoma, and a decrease in this response during the first 12 months after diagnosis and treatment was a significant prognostic indicator of survival. The probability of survival was 75% for patients whose antibody concentration to early antigen remained constant or decreased, and near 0% for patients with increasing levels of antibody.

Antibodies, Viral↗
PubMed1985

Sequence-specific DNA binding of the Epstein-Barr virus nuclear antigen (EBNA-1) to clustered sites in the plasmid maintenance region.

Latently infected B lymphocytes continuously express an Epstein-Barr Virus nuclear antigen (EBNA-1) required in trans for maintenance of the plasmid state of the EBV genome. Filter binding assays and DNAase I footprinting analyses revealed that the carboxy-terminal domain of EBNA-1 protects binding sites at three different loci in the 172,000 bp EBV genome. Two of these loci correspond to essential elements within an 1800 bp segment defined as the minimal region required for plasmid maintenance (ori-P). Binding to each of 20 X 30 bp tandem repeats in the "sink" locus protects 25 bp centered over a 12 bp palindromic consensus sequence TAGCATATGCTA. The nearby dyad symmetry "origin" locus contains two 46 bp protected regions each encompassing two paired core binding sites. The demonstration of sequence-specific binding at multiple loci suggests that EBNA-1 has pleiotropic functions, which may include control of copy number and segregation of the EBV plasmids as well as initiation of replication.

Antigens, Viral↗
PubMed1985

Carboxyl-terminal domain of the Epstein-Barr virus nuclear antigen is highly immunogenic in man.

The carboxyl-terminal one-third of the Epstein-Barr virus nuclear antigen (EBNA-1) encoded by the BamHI restriction fragment K was synthesized in Escherichia coli by use of a high-expression plasmid. The resultant 28-kDa EBNA fusion polypeptide, comprising 5-10% of the total soluble bacterial protein, was purified to apparent homogeneity by phosphocellulose and hydroxylapatite column chromatography. Both rabbit monospecific antibodies and mouse monoclonal antibodies against 28-kDa EBNA gave nuclear immunofluorescence staining on Epstein-Barr virus (EBV)-infected lymphoblastoid cell lines and recognized the appropriate intact EBNA polypeptide bands on immunoblots. An ELISA with the purified 28-kDa EBNA as antigen was used to quantitate anti-EBNA antibody in human serum samples. The ELISA method was approximately 100-fold more sensitive than the classical anticomplement immunofluorescence assay. Anti-EBNA antibody was detected in sera from 100% of normal individuals who were seropositive for the viral capsid antigen, and low anti-EBNA titers were detected in serum from most patients with acute infectious mononucleosis. The assay gave the expected pattern of titers in sera from patients with rheumatoid arthritis, Burkitt lymphoma, or nasopharyngeal carcinoma, thus confirming the validity of this purified reagent for assessing EBNA antibody status. Approximately 10% of normal individuals and rheumatoid arthritis patients had anti-EBNA titers as high as those seen in nasopharyngeal carcinoma patients. In these high-titer individuals, greater than 1% of the total IgG are antibodies that recognize 28-kDa EBNA, which indicates that the carboxyl-terminal domain of EBNA is highly immunogenic.

Amino Acid Sequence↗