PubMed Health⌕ Search

Biomedical subjects

G S Randhawa

Publications and source records attributed to G S Randhawa.

13 recordsLinked to original sources
PubMed2001

Role of ion track filters in environmental surveillance.

Ion track filters (ITFs) are produced by physiochemical treatments to thin films of polymers and mica irradiated by heavy ions. These ITFs have many applications in the fields of science and technology. In the present investigation, the developed ITFs from polycarbonate films have been used to filter bacteria of various types in water. It is observed that the electric conduction through these filters depends upon the concentration of contaminants and pore diameter of filters. Filtration experiments were carried out using both single and multipore filters. Other applications related to environment surveillance have also been reported.

Bacteria↗
PubMed2001

Ultrastructural studies on nodules induced by pyrimidine auxotrophs of Sinorhizobium meliloti.

Twenty three pyrimidine auxotrophs of Sinorhizobium meliloti Rmd201 were generated by random mutagenesis with transposon Tn5. On the basis of biochemical characters these auxotrophic mutants were classified into car, pyrC and pyrE/pyrF categories. All auxotrophs induced white nodules which were ineffective in nitrogen fixation. Light and electron microscopic studies revealed that the nodules induced by pyrC mutants were more developed than the nodules of car mutants. Similarly the nodules induced by pyrE/pyrF mutants had more advanced structural features than the nodules of pyrC mutants. The nodule development in case of pyrE/pyrF mutants was not to the extent observed in the parental strain. These results indicated that some of the intermediates and/or enzymes of pyrimidine biosynthetic pathway of S. meliloti play a key role in bacteroidal transformation and nodule development.

Medicago sativa↗
PubMed2000

Isolation and symbiotic characterization of aromatic amino acid auxotrophs of Sinorhizobium meliloti.

Ten aromatic amino acid auxotrophs of Sinorhizobium meliloti (previously called Rhizobium meliloti) Rmd201 were generated by random mutagenesis with transposon Tn5 and their symbiotic properties were studied. Normal symbiotic activity, as indicated by morphological features, was observed in the tryptophan synthase mutants and the lone tyrosine mutant. The trpE and aro mutants fixed trace amounts of nitrogen whereas the phe mutant was completely ineffective in nitrogen fixation. Histology of the nodules induced by trpE and aro mutants exhibited striking similarities. Each of these nodules contained an extended infection zone and a poorly developed nitrogen fixation zone. Transmission electron microscopic studies revealed that the bacteroids in the extended infection zone of these nodules did not show maturation tendency. A leaky mutant, which has a mutation in trpC, trpD, or trpF gene, was partially effective in nitrogen fixation. The histology of the nodules induced by this strain was like that of the nodules induced by the parental strain but the inoculated plants were stunted. These studies demonstrated the involvement of anthranilic acid and at least one more intermediate of tryptophan biosynthetic pathway in bacteroidal maturation and nitrogen fixation in S. meliloti. The alfalfa plant host seems to provide tryptophan and tyrosine but not phenylalanine to bacteroids in nodules.

Amino Acids↗
PubMed1998

Identification and mapping of human histone acetylation modifier gene homologues.

The products of histone acetyltransferase and deacetyltransferase genes regulate histone acetylation in eukaryotes, thereby regulating access of transcription factors to chromatin and modulating gene expression. Histone acetylation modifiers have been found to participate as cofactors in diverse mammalian transcriptional complexes involved in regulation of cellular proliferation and differentiation. A role for histone acetylase has been implicated in leukemias and developmental disorders. To gain insight into a role of additional potential histone acetylation modifier genes in human disease, we identified six histone acetyl-transferase or deacetyltransferase homologues using the dbEST database, and we mapped, using high-resolution FISH, a total of five family members to 1p34.3, 6q21-q22, 5q31, 3p24, and 17q21. We then identified human genetic disorders for which candidate genes are not yet known and that have been mapped to the same chromosomal regions as the histone acetylation modifiers. This analysis may help identify new candidate genes for human diseases that involve disturbances of histone acetylation.

Acetyltransferases↗
PubMed1998

Loss of imprinting in disease progression in chronic myelogenous leukemia.

The pathophysiologic role of the Philadelphia chromosome translocation in chronic myelogenous leukemia (CML) has been known for nearly 20 years. However, the most significant morbidity and mortality in CML are caused by progression to blast crisis, about which comparatively little is known at the molecular level. Genomic imprinting is a chromosomal modification leading to parental-origin-specific gene expression in somatic cells. Recently, we and others have described loss of imprinting (LOI) of the insulin-like growth factor-II gene (IGF2), leading to biallelic rather than monoallelic expression in a wide variety of solid tumors. We have now examined the imprinting status of IGF2 in samples from CML patients in stable phase, accelerated phase, and blast crisis. Five of six stable-phase patients showed normal imprinting, but LOI was found in all six cases of advanced disease (three accelerated phase, three blast crisis), which was statistically highly significant (P < .01). Thus, LOI represents a novel type of genetic alteration in CML that appears to be specifically associated with disease progression.

Blast Crisis↗
PubMed1994

The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function.

Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.

Animals↗
PubMed1993

Molecular approaches to the diagnosis and treatment of cancer.

We have used autologous bone marrow transplantation (ABMT) as a setting to develop the genetic therapy of cancer in hematopoietic neoplasms based on the use of the bone marrow as a conduit through which to introduce regulatory molecules into the patient. This has involved three developmental phases: 1) learning how to develop genetic modification techniques; 2) learning how to develop in vivo selection techniques for the genetically modified cells; and 3) developing molecular vectors for modification of hematopoietic cells for therapy of cancer. These programs will be summarized in terms of their progress at the conference.

Bone Marrow Transplantation↗
PubMed1993

Ectopically erupting canine--a case report.

Management of an ectopically erupting canine is discussed in this case report. Of the various treatment mechanics available to an Orthodontist today, a light elastic thread was used effectively, by the judicious placement of bonded attachments.

Adult↗
PubMed1983

Localization of symbiotic mutations in Rhizobium meliloti.

A total of 5 Nod- and 57 Fix- symbiotic mutants of Rhizobium meliloti strain 41 have been isolated after either nitrosoguanidine or Tn5 transposition mutagenesis. Chromosomal locations of mutations in 1 Nod- and 11 Fix- derivatives were ascertained by transferring the chromosome (mobilized by plasmid R68.45), in eight fragments, into symbiotically effective recipients and testing the recombinants for symbiotic phenotype. Alternatively, the kanamycin resistance marker of Tn5 was mapped. In five mutants the fix alleles were localized on different chromosomal regions, but six other fix mutations and one nod mutation tested did not map onto the chromosome. It was shown that the chromosome-mobilizing ability (Cma+) of R68.45 was not involved in the mobilization of genes located extrachromosomally. Moreover, Cma- derivatives of R68.45 could mobilize regions of the indigenous plasmid pRme41b but not chromosomal genes. Thus, mobilization of a marker by Cma- R68.45 indicates its extrachromosomal location. With a 32P-labeled DNA fragment carrying Tn5 as a hybridization probe, it was shown that in five extrachromosomally located Tn5-induced fix mutants and one nod mutant Tn5 was localized on plasmid pRme41b. This is in agreement with the genetic mapping data.

Chromosome Mapping↗