PubMed Health⌕ Search

Biomedical subjects

G V Paddock

Publications and source records attributed to G V Paddock.

14 recordsLinked to original sources
PubMed1978

The primary sequence of rabbit alpha-globin mRNA.

The rabbit alpha-globin DNA insertion in the chimeric plasmid pHb 72 (Liu et al., 1977) has been sequenced by the method of Maxam and Gilbert (1977). This has enabled us to determine the messenger RNA(mRNA) sequence beginning in the 5' untranslated region 9 nucleotides before the initiation codon and extending through the first 361 nucleotides of the translated region. The data reported here overlap and are in complete agreement with sequences determined by Baralle (1977) for the 5' end of the mRNA and by Proudfoot et al. (1977) for the 3' end. Our sequence is also in agreement with the partial complementary RNA (cRNA) sequencing data which we reported previously (Paddock et al., 1977), this work marks the completion of the primary sequence of the rabbit alpha-globin mRNA. These observations reaffirm the high fidelity with which gene copies can be synthesized in vitro, cloned in a bacterial plasmid and maintained in the host. The general features of the mRNA nucleotide sequence are duscussed with particular attention given to the base composition and codon preferences observed and to comparison of this sequence with other completed mRNA gene sequences. A new computer program has been used to search for the most stable base-pairing arrangement of the completed mRNA.

Amino Acid Sequence↗
PubMed1978

Characterization of an immunoglobin cDNA clone containing the variable and constant regions for the MOPC 21 kappa light chain.

Nucleotide sequence analysis and restriction endonuclease mapping have been used to characterize a cDNA copy of immunoglobulin MOPC 21 Kappa mRNA clones in the bacterial plasmid pMB9. Three regions of the inserted cDNA of plasmid pL21-1 have been sequenced and match the known protein sequence at amino acid residues 1-24, 128-138 and 171-179. With these sequences to provide absolute correlations between the restriction map and the structural gene sequence it has been possible to exactly deduce the positions of all 11 of the insert restriction sites mapped within the structural gene. The pL21-1 insert contains the complete variable and constant regions as well as parts of the 3' untranslated and polypeptide leader coding sequences.

Amino Acid Sequence↗
PubMed1977

Rabbit globin mRNA: analysis of T1 RNAse digestion fragments.

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as a template for in vitro synthesis of 32P-labeled RNA and deoxysubstituted RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. In addition, the 3' nearest neighbor was determined for several fragments resulting from digestion with T1 ribonuclease. The utility of the deoxysubstitution technique was demonstrated by the ease with which the sequences of pyrimidine-rich fragments could be determined. Many sequences thus determined were long enough to fit uniquely with the alpha- or beta-globin amino acid sequences. The positions of these fits were found to be clustered, leading us to believe that only certain regions of the complementary DNA are transcribed by Escherichia coli RNA polymerase. Other unique characteristics of RNA synthesis from a complementary DNA template include a high yield of free poly(A) and the fact that one must use low rather than high salt buffers to obtain transcripts of high molecular weight.

Amino Acid Sequence↗
PubMed1977

Nucleotide sequences from a rabbit alpha globin gene inserted in a chimeric plasmid.

Rabbit alpha globin gene copies have been made, using reverse transcriptase and DNA polymerase I, and cloned in bacterial plasmids. Plasmid pHb72 has been shown to contain the alpha gene sequence by restriction enzyme analysis and nucleotide sequencing studies, and therefore has been approved for propagation under P2 plus EK1 conditions by the National REcombinant DNA Committee.

Base Sequence↗
PubMed1977

The ovalbumin gene. Insertion of ovalbumin gene sequences in chimeric bacterial plasmids.

Double-stranded ovalbumin DNA was amplified and purified by the cloning of bacterial transformants. The double-stranded DNA was synthesized from a complete complementary DNA transcript of ovalbumin mRNA using Escherichia coli DNA polymerase I and the self-priming ability of the initial transcript. After S. nuclease treatment, poly(dA) was added to the 3' termini with terminal deoxynucleotidyltransferase and the ovalbumin gene was hybridized to a linear plasmid DNA, pMB9, containing 3'-poly(dT) termini. This hybrid molecule was used to transform the E. coli strain X1849. The cloned transformants contained from 30 to 53% of the complete ovalbumin DNA as determined by hybridization with full length cDNA. The length of the inserts was confirmed by treatment of the isolated plasmids with the restriction enzyme Hha I. Separation of the fragments by agarose gel electrophoresis showed that the amount of inserted DNA in clones tested varied from 680 to 1090 base pairs.

Animals↗
PubMed1976

A general method for cloning eukaryotic structural gene sequences.

Complementary DNA, transcribed in vitro from purified rabbit globin messenger RNA and made double-stranded, has been inserted into Escherichia coli plasmids pSC101 and pMB9 by the poly(dT)/poly(dA) "tailing" and annealing technique. E. coli transformants given by this DNA preparation have been shown to contain globin sequences by the hybridization of globin RNA to DNA from clones grown and lysed in situ on nitrocellulose filters. An estimate of the amount of inserted globin sequences has been provided by fingerprint analysis of globin mRNA sequences hybridized to the purified plasmid chimeras. Inserted sequences so far subjected to detailed analysis have been ascribed to the rabbit beta globin chain. The susceptibility of inserted beta globin, sequences to the restriction endonuclease EcoRI confirms the existence of a site already found through previous nucleotide sequence analysis.

Base Sequence↗
PubMed1976

Cleavage of T4 species I ribonucleic acid by Escherichia coli ribonuclease III.

T4 Species I RNA, a molecule 140 nucleotides in length with some structural features very much like a tRNA, is specifically cleaved by an enzymatic activity in Escherichia coli extracts to give three segments with 19, 48 and 73 nucleotides. We report the purification and characterization of the E. coli RNase which cleaves two 3' phosphodiester bonds of T4 Species I RNA. This reaction has many properties in common with those catalyzed by E. coli RNase III, although the optimal salt conditions for T4 Species I RNA cleavage differ significantly from those for other RNase III-catalyzed reactions. The reaction is not catalyzed by extracts from an E. coli strain lacking RNase III activity. Furthermore, T4 Species I RNA is cleaved by highly purified E. coli RNase III to yield the same three specific fragments. We conclude that this specific cleavage is due to the action of RNase III, and that the requirement for lower ionic strength may reveal further important properties about this RNA processing enzyme.

Cations, Divalent↗
PubMed1975

Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid.

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.

Alkaline Phosphatase↗
PubMed1975

Nucleotide sequence determination of bacteriophage T2 and T6 species I ribonucleic acids.

The nucleotide sequences of species I RNA coded for by bacteriophages T2 and T6 have been analyzed using 32-P-labeled material from T2 and T6-infected cultures of Escherichia coli. The T1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from T4 species I RNA to obtain a minimum estimate of the number of nucleotide sequence differences among the three species I RNAs. Analysis of fragments obtained by digestion with epsilon-carboxymethyl-lysine-41-pancreatic ribonuclease and with E. coli Q13 S30 crude extract was also performed to provide some additional confirmation for the nucleotide sequences that were derived for the T2 and T6 species I RNAs. T2 species I RNA was found to be different at three positions in the nucleotide sequence, and unlike T4 species I RNA, contained in addition the modified nucleotide, psi, in a region where the proposed secondary structure is identical to the TpsiC-loop of a tRNA. T6 species I RNA was found to contain nucleotide differences from the T4 species I RNA sequence at four positions. The U at position 119 in the sequence appears to be modified to psi only to a small extent. While a biological function for species I RNA is unknown, the fact that there is over 97% homology in the sequences suggests strong evolutionary pressures to retain the nucleotide sequence in the T-even genomes.

Base Sequence↗