PubMed Health⌕ Search

Biomedical subjects

Garry R Buettner

Publications and source records attributed to Garry R Buettner.

At least 19 recordsLinked to original sources
PubMed2007

Tin protoporphyrin induces intestinal chloride secretion by inducing light oxidation processes.

Heme induces Cl(-) secretion in intestinal epithelial cells, most likely via carbon monoxide (CO) generation. The major source of endogenous CO comes from the degradation of heme via heme oxygenase (HO). We hypothesized that an inhibitor of HO activity, tin protoporphyrin (SnPP), may inhibit the stimulatory effect of heme on Cl(-) secretion. To test this hypothesis, we treated an intestinal epithelial cell line (Caco-2 cells) with SnPP. In contrast to our expectations, Caco-2 cells treated with SnPP had an increase in their short-circuit currents (I(sc)) in Ussing chambers. This effect was observed only when the system was exposed to ambient light. SnPP-induced I(sc) was caused by Cl(-) secretion because it was inhibited in Cl(-)-free medium, with ouabain or 5-nitro-2-(3-phenylpropylamino)benzoic acid (NPPB). The Cl(-) secretion was not via activation of the CFTR, because a specific inhibitor had no effect. Likewise, inhibitors of adenylate cyclase and guanylate cyclase had no effect on the enhanced I(sc). SnPP-induced I(sc) was inhibited by the antioxidant vitamins, alpha-tocopherol and ascorbic acid. Electron paramagnetic resonance experiments confirmed that oxidative reactions were initiated with light in cells loaded with SnPP. These data suggest that SnPP-induced effects may not be entirely due to the inhibition of HO activity but rather to light-induced oxidative processes. These novel effects of SnPP-photosensitized oxidation may also lead to a new understanding of how intestinal Cl(-) secretion can be regulated by the redox environment of the cell.

Antioxidants↗
PubMed2006

A new paradigm: manganese superoxide dismutase influences the production of H2O2 in cells and thereby their biological state.

The principal source of hydrogen peroxide in mitochondria is thought to be from the dismutation of superoxide via the enzyme manganese superoxide dismutase (MnSOD). However, the nature of the effect of SOD on the cellular production of H(2)O(2) is not widely appreciated. The current paradigm is that the presence of SOD results in a lower level of H(2)O(2) because it would prevent the non-enzymatic reactions of superoxide that form H(2)O(2). The goal of this work was to: a) demonstrate that SOD can increase the flux of H(2)O(2), and b) use kinetic modelling to determine what kinetic and thermodynamic conditions result in SOD increasing the flux of H(2)O(2). We examined two biological sources of superoxide production (xanthine oxidase and coenzyme Q semiquinone, CoQ(*-) that have different thermodynamic and kinetic properties. We found that SOD could change the rate of formation of H(2)O(2) in cases where equilibrium-specific reactions form superoxide with an equilibrium constant (K) less than 1. An example is the formation of superoxide in the electron transport chain (ETC) of the mitochondria by the reaction of ubisemiquinone radical with dioxygen. We measured the rate of release of H(2)O(2) into culture medium from cells with differing levels of MnSOD. We found that the higher the level of SOD, the greater the rate of accumulation of H(2)O(2). Results with kinetic modelling were consistent with this observation; the steady-state level of H(2)O(2) increases if K<1, for example CoQ(*-)+O(2)-->CoQ+O(2)(*-). However, when K>1, e.g. xanthine oxidase forming O(2)(*-), SOD does not affect the steady state-level of H(2)O(2). Thus, the current paradigm that SOD will lower the flux of H(2)O(2) does not hold for the ETC. These observations indicate that MnSOD contributes to the flux of H(2)O(2) in cells and thereby is involved in establishing the cellular redox environment and thus the biological state of the cell.

Animals↗
PubMed2006

Nitric oxide decreases the stability of DMPO spin adducts.

The effect nitric oxide (NO*) on the stability of 5,5-dimethyl-1-pyrroline-N-oxide (DMPO) adducts has been investigated using EPR spectroscopy. We report that the DMPO/HO* adduct, generated by porcine pulmonary artery endothelial cells in the presence of H2O2 and DMPO, or by a Fenton system (Fe(II)+H2O2) is degraded in the presence of the NO*-donor, 2-(N,N-diethylamino)-diazenolate-2-oxide (DEANO) or by bolus addition of an aqueous solution of NO*. A similar effect of DEANO was observed on other DMPO adducts, such as DMPO/*CH3 and DMPO/*CH(CH3)OH, generated in cell-free systems. Measurements of the loss of DMPO/HO* in the presence of DEANO in aerated and oxygen-free buffers showed that in both of these settings the process obeys first-order kinetics and proceeds with similar efficacy. This indicates that direct interaction of the nitroxide with NO*, rather than with NO2* (formed from NO* and O2 in aerated media), is responsible for destruction of the spin adduct. These results suggest that the presence of NO* may substantially affect the quantitative determination of DMPO adducts. We also show that NO2* radicals, generated by a myeloperoxidase/H2O2/nitrite system, also degrade DMPO/HO*. Because DMPO is frequently used to study generation of superoxide and hydroxyl radicals in biological systems, these observations indicate that extra caution is required when studying generation of these species in the presence of NO* or NO2* radicals.

Animals↗
PubMed2006

Ascorbate enhances the toxicity of the photodynamic action of Verteporfin in HL-60 cells.

As a reducing agent, ascorbate serves as an antioxidant. However, its reducing function can in some settings initiate an oxidation cascade, i.e., seem to be a "pro-oxidant." This dichotomy also seems to hold when ascorbate is present during photosensitization. Ascorbate can react with singlet oxygen, producing hydrogen peroxide. Thus, if ascorbate is present during photosensitization the formation of highly diffusible hydrogen peroxide could enhance the toxicity of the photodynamic action. On the other hand, ascorbate could decrease toxicity by converting highly reactive singlet oxygen to less reactive hydrogen peroxide, which can be removed via peroxide-removing systems such as glutathione and catalase. To test the influence of ascorbate on photodynamic treatment we incubated leukemia cells (HL-60 and U937) with ascorbate and a photosensitizer (Verteporfin; VP) and examined ascorbic acid monoanion uptake, levels of glutathione, changes in membrane permeability, cell growth, and toxicity. Accumulation of VP was similar in each cell line. Under our experimental conditions, HL-60 cells were found to accumulate less ascorbate and have lower levels of intracellular GSH compared to U937 cells. Without added ascorbate, HL-60 cells were more sensitive to VP and light treatment than U937 cells. When cells were exposed to VP and light, ascorbate acted as an antioxidant in U937 cells, whereas it was a pro-oxidant for HL-60 cells. One possible mechanism to explain these observations is that HL-60 cells express myeloperoxidase activity, whereas in U937 cells it is below the detection limit. Inhibition of myeloperoxidase activity with 4-aminobenzoic acid hydrazide (4-ABAH) had minimal influence on the phototoxicity of VP in HL-60 cells in the absence of ascorbate. However, 4-ABAH decreased the toxicity of ascorbate on HL-60 cells during VP photosensitization, but had no affect on ascorbate toxicity in U937 cells. These data demonstrate that ascorbate increases hydrogen peroxide production by VP and light. This hydrogen peroxide activates myeloperoxidase, producing toxic oxidants. These observations suggest that in some settings, ascorbate may enhance the toxicity of photodynamic action.

Antioxidants↗
PubMed2005

Manganese superoxide dismutase suppresses hypoxic induction of hypoxia-inducible factor-1alpha and vascular endothelial growth factor.

Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that governs cellular responses to reduced O2 availability by mediating crucial homeostatic processes. HIF-1 is composed of an HIF-1alpha subunit and an HIF-1beta subunit. HIF-1alpha is degraded following enzyme-dependent hydroxylation of prolines of HIF-1alpha in the presence of molecular oxygen, Fe2+, alpha-ketoglutarate, and ascorbate. These cofactors contribute to the redox environment of cells. The antioxidant enzyme manganese superoxide dismutase (MnSOD) also modulates the cellular redox environment. Here we show that MnSOD suppressed hypoxic accumulation of HIF-1alpha protein in human breast carcinoma MCF-7 cells. This suppression was biphasic depending on MnSOD activity. At low levels of MnSOD activity, HIF-1alpha protein accumulated under hypoxic conditions. At moderate levels of MnSOD activity (two- to six-fold increase compared to parent cells), these accumulations were blocked. However, at higher levels of MnSOD activity (>6-fold increase), accumulation of HIF-1alpha protein was again observed. This biphasic modulation was observed under both 1 and 4% O2. Coexpression of mitochondrial hydrogen peroxide-removing proteins prevented the accumulation of HIF-1alpha protein in cells with high levels of MnSOD; this effect demonstrates that the restabilization of HIF-1alpha observed in high MnSOD overexpressors is probably due to hydrogen peroxide, most likely produced from MnSOD. Hypoxic induction of vascular endothelial growth factor (VEGF) protein was also suppressed by elevated MnSOD activity and its levels reflected HIF-1alpha protein levels. These observations demonstrated that HIF-1alpha accumulation and VEGF expression could be modulated by the antioxidant enzyme MnSOD.

Adenocarcinoma↗
PubMed2005

Nitric oxide as a cellular antioxidant: a little goes a long way.

Nitric oxide (NO*) is an effective chain-breaking antioxidant in free radical-mediated lipid oxidation (LPO). It reacts rapidly with peroxyl radicals as a sacrificial chain-terminating antioxidant. The goal of this work was to determine the minimum threshold concentration of NO* required to inhibit Fe2+ -induced cellular lipid peroxidation. Using oxygen consumption as a measure of LPO, we simultaneously measured nitric oxide and oxygen concentrations with NO* and O2 electrodes. Ferrous iron and dioxygen were used to initiate LPO in docosahexaenoic acid-enriched HL-60 and U937 cells. Bolus addition of NO* (1.5 microM) inhibited LPO when the NO* concentration was greater than 50 nM. Similarly, using (Z)-1-[N-(3-ammoniopropyl)-N-(n-propyl)amino]diazen-1-ium-1,2-diolate as a NO* donor we found that an average steady-state NO* concentration of at least 72 +/- 9 nM was required to blunt LPO. As long as the concentration of NO* was above 13 +/- 8 nM the inhibition was sustained. Once the concentration of NO* fell below this value, the rate of lipid oxidation accelerated as measured by the rate of oxygen consumption. Our model suggests that a continuous production of NO* that would yield a steady-state concentration of only 10-20 nM is capable of inhibiting Fe2+ -induced LPO.

Antioxidants↗
PubMed2005

Pharmacologic ascorbic acid concentrations selectively kill cancer cells: action as a pro-drug to deliver hydrogen peroxide to tissues.

Human pharmacokinetics data indicate that i.v. ascorbic acid (ascorbate) in pharmacologic concentrations could have an unanticipated role in cancer treatment. Our goals here were to test whether ascorbate killed cancer cells selectively, and if so, to determine mechanisms, using clinically relevant conditions. Cell death in 10 cancer and 4 normal cell types was measured by using 1-h exposures. Normal cells were unaffected by 20 mM ascorbate, whereas 5 cancer lines had EC(50) values of <4 mM, a concentration easily achievable i.v. Human lymphoma cells were studied in detail because of their sensitivity to ascorbate (EC(50) of 0.5 mM) and suitability for addressing mechanisms. Extracellular but not intracellular ascorbate mediated cell death, which occurred by apoptosis and pyknosis/necrosis. Cell death was independent of metal chelators and absolutely dependent on H(2)O(2) formation. Cell death from H(2)O(2) added to cells was identical to that found when H(2)O(2) was generated by ascorbate treatment. H(2)O(2) generation was dependent on ascorbate concentration, incubation time, and the presence of 0.5-10% serum, and displayed a linear relationship with ascorbate radical formation. Although ascorbate addition to medium generated H(2)O(2), ascorbate addition to blood generated no detectable H(2)O(2) and only trace detectable ascorbate radical. Taken together, these data indicate that ascorbate at concentrations achieved only by i.v. administration may be a pro-drug for formation of H(2)O(2), and that blood can be a delivery system of the pro-drug to tissues. These findings give plausibility to i.v. ascorbic acid in cancer treatment, and have unexpected implications for treatment of infections where H(2)O(2) may be beneficial.

Antioxidants↗
PubMed2005

Doxorubicin increases intracellular hydrogen peroxide in PC3 prostate cancer cells.

We studied the effect of doxorubicin on the production of hydrogen peroxide by PC3 human prostate cancer cells, using a sensitive assay based on aminotriazole-mediated inhibition of catalase. PC3 cells exposed to increasing concentrations of doxorubicin had an increase in intracellular hydrogen peroxide that was concentration-dependent up to 1 microM doxorubicin. The apparent hydrogen peroxide concentration in the PC3 cells was 13 +/- 4 pM under basal steady-state conditions and increased to 51 +/- 13 pM after exposure to 1 microM doxorubicin for 30 min. The level of hydrogen peroxide in the medium as measured by Amplex Red did not increase as a result of doxorubicin treatment. PC3 cells overexpressing catalase were no more resistant to doxorubicin cytotoxicity as compared to non-transduced wild-type cells; therefore, the exact role of hydrogen peroxide in anthracycline cytotoxicity remains unproven. This study demonstrates that a specific oxidative event associated with the exposure of PC3 human prostate cancer cells to anthracyclines results in an increase in intracellular hydrogen peroxide.

Amitrole↗
PubMed2005

Manganese superoxide dismutase overexpression inhibits the growth of androgen-independent prostate cancer cells.

This study investigates the role of the antioxidant enzyme manganese superoxide dismutase (MnSOD) in androgen-independent human prostate cancer (PC-3) cells' growth rate in vitro and in vivo. MnSOD levels were found to be lower in parental PC-3 cells compared to nonmalignant, immortalized human prostate epithelial cells (P69SV40T). To unravel the role of MnSOD in the prostate cancer phenotype, PC-3 cells were stably transfected with MnSOD cDNA plasmid. The MnSOD protein and activity levels in clones overexpressing MnSOD were increased seven- to eightfold. These cell lines showed elongated cell doubling time, reduced anchorage-independent growth in soft agar compared to parental PC-3 (Wt) cells, and reduced growth rate of PC-3 tumor xenografts in athymic nude mice. Flow cytometric studies showed an increase in membrane potential in the MnSOD-overexpressing clone (Mn32) compared to Wt and Neo cells. Also, production of extracellular H(2)O(2) was increased in the MnSOD-overexpressing clones. As determined by DNA cell cycle analysis, the proportion of cells in G(1) phase was enhanced by MnSOD overexpression. Therefore, MnSOD not only regulates cell survival but also affects PC-3 cell proliferation by retarding G(1) to S transition. Our results are consistent with MnSOD being a tumor suppressor gene in human prostate cancer.

Androgens↗
PubMed2004

Mitochondrial O2*- and H2O2 mediate glucose deprivation-induced stress in human cancer cells.

The hypothesis that glucose deprivation-induced cytotoxicity in transformed human cells is mediated by mitochondrial O2*- and H2O2 was first tested by exposing glucose-deprived SV40-transformed human fibroblasts (GM00637G) to electron transport chain blockers (ETCBs) known to increase mitochondrial O2*- and H2O2 production (antimycin A (AntA), myxothiazol (Myx), or rotenone (Rot)). Glucose deprivation (2-8 h) in the presence of ETCBs enhanced parameters indicative of oxidative stress (i.e. GSSG and steady-state levels of oxygen-centered radicals) as well as cytotoxicity. Glucose deprivation in the presence of AntA also significantly enhanced cytotoxicity and parameters indicative of oxidative stress in several different human cancer cell lines (PC-3, DU145, MDA-MB231, and HT-29). In addition, human osteosarcoma cells lacking functional mitochondrial electron transport chains (rho0) were resistant to glucose deprivation-induced cytotoxicity and oxidative stress in the presence of AntA. In the absence of ETCBs, aminotriazole-mediated inactivation of catalase in PC-3 cells demonstrated increases in intracellular steady-state levels of H2O2 during glucose deprivation. Finally, in the absence of ETCBs, overexpression of manganese containing superoxide dismutase and/or mitochondrial targeted catalase using adenoviral vectors significantly protected PC-3 cells from toxicity and oxidative stress induced by glucose deprivation with expression of both enzymes providing greater protection than was seen with either alone. Overall, these findings strongly support the hypothesis that mitochondrial O2*- and H2O2 significantly contribute to glucose deprivation-induced cytotoxicity and metabolic oxidative stress in human cancer cells.

Adenosine Triphosphate↗
PubMed2004

High levels of catalase and glutathione peroxidase activity dampen H2O2 signaling in human alveolar macrophages.

Results are presented which support the hypothesis that adequate steady-state levels of hydrogen peroxide (H2O2) are required to overcome the effects of high catalase and glutathione peroxidase (GPx) expression for p38 mitogen-activated protein (MAP) kinase activation and tumor necrosis factor (TNF)-alpha gene expression in human alveolar macrophages stimulated with asbestos. We found significant differences in the types and amounts of reactive oxygen species generated in human blood monocytes compared with human alveolar macrophages. This difference in reactive oxygen species production is related, in part, to the differences in antioxidant enzyme expression and activity. Most importantly, catalase and GPx activities were significantly increased in alveolar macrophages compared with blood monocytes. Asbestos activated the p38 MAP kinase and induced TNF-alpha gene expression only in blood monocytes. Increasing the steady-state levels of H2O2 by using polyethylene glycol superoxide dismutase, an antioxidant that crosses the cell membrane, or aminotriazole, an irreversible inhibitor of catalase, allowed the p38 MAP kinase to be activated in alveolar macrophages. In addition, asbestos-stimulated macrophages cultured with polyethylene glycol superoxide dismutase had a significant increase in gene expression mediated by the TNF-alpha promoter. These results demonstrate that high catalase and GPx activity in human alveolar macrophages limits the effectiveness of H2O2 to act as a mediator of inflammatory gene expression.

Adolescent↗
PubMed2004

Endogenous production and exogenous exposure to nitric oxide augment doxorubicin cytotoxicity for breast cancer cells but not cardiac myoblasts.

We studied the effect of nitric oxide (*NO) on the anticancer activity of doxorubicin. When MCF-7 human breast cancer cells were exposed to an aqueous solution of *NO delivered as a bolus 30 min prior to doxorubicin, the cytotoxic effect as measured in a clonogenic assay was increased (doxorubicin alone, 40% survival, doxorubicin plus *NO, 5% survival). The *NO donor diethylamine nitric oxide, but not inactivated donor, also yielded an increase in doxorubicin cytotoxicity. The sequence was important since the simultaneous application of *NO with doxorubicin yielded only a small augmentation of effect, and the exposure of the cells to doxorubicin prior to the *NO obliterated the augmentation. Prior depletion of glutathione by incubation of the cells for 24h with D,L-buthionine-S,R-sulfoximine (BSO) further increased the cytotoxicity so that BSO plus *NO plus doxorubicin killed all of the clones. MCF-7 cells transduced with inducible nitric oxide synthase gene (iNOS) through an adenoviral vector overexpressed iNOS and produced increased amounts of nitrite, an indicator of increased *NO production. These iNOS transduced cells were more susceptible to doxorubicin than vector control or wild-type cells. Cell cycle progression of iNOS transduced cells was not different from controls. Likewise, iNOS transduction resulted in no change in cellular glutathione levels. For comparison, we examined the effect of iNOS transduction on the sensitivity of MCF-7 to edelfosine, a membrane-localizing anticancer drug without direct DNA interaction. Insertion of the iNOS had no effect on killing of the MCF-7 cells by this ether lipid class drug. We also tested the effect of iNOS transduction on doxorubicin sensitivity of H9c2 rat heart-derived myoblasts. We found no augmentation of cytotoxicity by *NO, and this observation offers potential therapeutic tumor selectivity by using *NO with doxorubicin. Therefore, we conclude that *NO produced intracellularly by iNOS overexpression or delivered as a bolus sensitizes human breast cancer cells in culture to doxorubicin, but not to a cardiac cell line or to edelfosine. This augmentation is not due to a modulation of cell cycle distribution or measurable cellular glutathione resulting from the transduction.

Adenoviridae↗
PubMed2004

The nitric oxide synthase inhibitor N(G)-nitro-L-arginine decreases defibrillation-induced free radical generation.

OBJECTIVES: to demonstrate that nitric oxide (NO) contributes to free radical generation after epicardial shocks and to determinethe effect of a nitric oxide synthase (NOS) inhibitor, N(G)-nitro-L-arginine (L-NNA), on free radical generation. BACKGROUND: Free radicals are generated by direct current shocks for defibrillation. NO reacts with the superoxide (O2*-) radical to for peroxynitrite (O = NOO-), which is toxic and initiates additional free radical generation. The contribution of NO to free radical generation after defibrillation is not fully defined. METHODS AND RESULTS: Fourteen open chest dogs were studied. In the initial eight dogs, 40 J damped sinusoidal monophasic epicardial shocks was administered. Using electron paramagnetic resonance, we monitored the coronary sinus concentration of ascorbate free radical (Asc*-), a measure of free radical generation (total oxidative flux). Epicardial shocks were repeated after L-NNA, 5 mg/kg IV. In six additional dogs, immunohistochemical staining was done to identify nitrotyrosine, a marker of reactive nitrogen species-mediated injury, in post-shock myocardial tissue. Three of these dogs received L-NNA pre-shock. After the initial 40 J shock, Asc*- rose 39 +/- 2.5% from baseline. After L-NNA infusion, a similar 40 J shock caused Asc*- to increase only 2 +/- 3% form baseline (P < 0.05, post-L-NNA shock versus initial shock). Nitrotyrosine staining was more prominent in control animals than dogs receiving L-NNA, suggesting prevention of O = NOO- formation. CONCLUSION: NO contributes to free radical generation and nitrosative injury after epicardial shocks; NOS inhibitors decrease radical generation by inhibiting the production of O = NOO-.

Animals↗
PubMed2004

Overexpression of manganese superoxide dismutase promotes the survival of prostate cancer cells exposed to hyperthermia.

It has been hypothesized that exposure of cells to hyperthermia results in an increased flux of reactive oxygen species (ROS), primarily superoxide anion radicals, and that increasing antioxidant enzyme levels will result in protection of cells from the toxicity of these ROS. In this study, the prostate cancer cell line, PC-3, and its manganese superoxide dismutase (MnSOD)-overexpressing clones were subjected to hyperthermia (43 degrees C, 1 h). Increased expression of MnSOD increased the mitochondrial membrane potential (MMP). Hyperthermic exposure of PC-3 cells resulted in increased ROS production, as determined by aconitase inactivation, lipid peroxidation, and H2O2 formation with a reduction in cell survival. In contrast, PC-3 cells overexpressing MnSOD had less ROS production, less lipid peroxidation, and greater cell survival compared to PC-3 Wt cells. Since MnSOD removes superoxide, these results suggest that superoxide free radical or its reaction products are responsible for part of the cytotoxicity associated with hyperthermia and that MnSOD can reduce cellular injury and thereby enhance heat tolerance.

Aconitate Hydratase↗
PubMed2004

Detection of lipid radicals using EPR.

Cells oxidize molecules to generate energy and to make the materials to build and support the structures and functions needed for life. However, unwanted oxidations can damage these same structures and impair function. Lipids (the lipids in membranes and lipoproteins) are targets of unwanted oxidations. The primary mechanism of these oxidations is free radical-mediated chain reactions. Here we provide an overview of how electron paramagnetic resonance (EPR) can be used to detect the free radicals formed during lipid peroxidation. Although direct detection of lipid-derived radicals has been accomplished, the approach is not feasible for detecting these radicals in cells. Spin trapping with alpha-(4-pyridyl-1-oxide)-N-tert-butylnitrone and 5,5-dimethyl-pyrroline-1-oxide has provided the most information on cellular lipid peroxidation. We present some considerations for successful detection of lipid radicals by EPR.

Cell Line, Tumor↗
PubMed2003

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

Base Sequence↗
PubMed2003

Evidence for oxidative stress in NSAID-induced colitis in IL10-/- mice.

The goal of this study was to evaluate for evidence of oxidative stress in colonic inflammation in a novel model of inflammatory bowel disease, nonsteroidal anti-inflammatory drug- (NSAID-) treated interleukin-10-deficient (IL10(-/-)) mice. IL10(-/-) and wild-type (wt) mice were treated with a nonselective NSAID (piroxicam, 200 ppm in the diet) for 2 weeks to induce colitis, and parameters for oxidative stress in the colonic tissues were evaluated. Mean chemiluminescence enhanced with lucigenin in the colons from IL10(-/-) mice treated with piroxicam was more than 5-fold higher than that of the control wt group. Chemiluminescence was inhibited with diphenylethylene iodinium, but not allopurinol, indomethacin, or N-omega-nitro-L-arginine, indicating that flavin-containing enzymes were the source of the reactive oxygen species. Colonic aconitase activity in NSAID-treated IL10(-/-) mice decreased to 50% of the activity of control mice. There was no difference in the total glutathione levels in the colonic mucosa among the groups; however, glutathione disulfide levels were approximately 2-fold greater in the colon of NSAID-treated IL10(-/-) mice as compared with control groups. Immunohistochemistry studies of colons from NSAID-treated IL10(-/-) mice demonstrated intense staining with two antibodies that recognize advanced glycation endproducts formed through glycation and oxidation: anticarboxymethylysine and antipentosidine. The epithelial cells and lamina propria cells in the colons of NSAID-treated IL10(-/-) mice showed immunostaining with antinitrotyrosine, indicating the presence of reactive nitrogen species. Colonic epithelium of IL10(-/-) mice with colitis showed moderate immunostaining for 8-hydroxy-2'-deoxyguanosine in the nuclei. NSAID-treated IL10(-/-) mice treated with diphenylene idodonium chloride (DPI), an irreversible inhibitor of flavoprotein enzymes, experienced significantly reduced inflammation. Taken together, these results strongly indicate the presence of oxidative stress in the inflammatory bowel disease in NSAID-treated IL10(-/-) mice and suggests a role for oxidative stress in the pathophysiology of this model of inflammatory bowel disease.

8-Hydroxy-2'-Deoxyguanosine↗