Biomedical subjects

Gynheung An

Publications and source records attributed to Gynheung An.

At least 19 recordsLinked to original sources

PubMed2007

Isolation of cold stress-responsive genes in the reproductive organs, and characterization of the OsLti6b gene from rice (Oryza sativa L.).

During their reproductive stage, rice crops often are exposed to cold stress, which leads to sterility and reduced yields. To understand the cold response mechanism at that stage, we used an mRNA differential display method to isolate cold-responsive genes from pre-anthesis flowers. Approximately 5,000 transcripts were identified here, of which 123 were found to be displayed differentially between the control (30 degrees C) and cold-treated (12 degrees C) flowers. Among them, 26 were analyzed by northern analysis; 8 of those clones were confirmed as cold-responsive. OsLti6b, encoding a hydrophobic protein homologous to Arabidopsis RCI2, was analyzed in detail. RNA blot analysis revealed that its transcript is increased by cold, salt, drought, or ABA treatments. In situ hybridization indicated that this transcript is highly accumulated in the ovaries and stamens of cold-treated flowers, particularly in the anther walls and vascular tissues of the filaments. Over-expression of OsLti6b increased cold tolerance as revealed by seedling wilting rates and ion leakages of mature leaves, demonstrating that the extent of the tolerance correlates well with its expression level.

Cold Temperature↗

PubMed2007

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase alpha2 gene that is essential for expression.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

Arabidopsis↗

PubMed2007

Rice SCAMP1 defines clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in tobacco BY-2 cells.

We recently identified multivesicular bodies (MVBs) as prevacuolar compartments (PVCs) in the secretory and endocytic pathways to the lytic vacuole in tobacco (Nicotiana tabacum) BY-2 cells. Secretory carrier membrane proteins (SCAMPs) are post-Golgi, integral membrane proteins mediating endocytosis in animal cells. To define the endocytic pathway in plants, we cloned the rice (Oryza sativa) homolog of animal SCAMP1 and generated transgenic tobacco BY-2 cells expressing yellow fluorescent protein (YFP)-SCAMP1 or SCAMP1-YFP fusions. Confocal immunofluorescence and immunogold electron microscopy studies demonstrated that YFP-SCAMP1 fusions and native SCAMP1 localize to the plasma membrane and mobile structures in the cytoplasm of transgenic BY-2 cells. Drug treatments and confocal immunofluorescence studies demonstrated that the punctate cytosolic organelles labeled by YFP-SCAMP1 or SCAMP1 were distinct from the Golgi apparatus and PVCs. SCAMP1-labeled organelles may represent an early endosome because the internalized endocytic markers FM4-64 and AM4-64 reached these organelles before PVCs. In addition, wortmannin caused the redistribution of SCAMP1 from the early endosomes to PVCs, probably as a result of fusions between the two compartments. Immunogold electron microscopy with high-pressure frozen/freeze-substituted samples identified the SCAMP1-positive organelles as tubular-vesicular structures at the trans-Golgi with clathrin coats. These early endosomal compartments resemble the previously described partially coated reticulum and trans-Golgi network in plant cells.

Amino Acid Sequence↗

PubMed2006

Wax-deficient anther1 is involved in cuticle and wax production in rice anther walls and is required for pollen development.

In vegetative leaf tissues, cuticles including cuticular waxes are important for protection against nonstomatal water loss and pathogen infection as well as for adaptations to environmental stress. However, their roles in the anther wall are rarely studied. The innermost layer of the anther wall (the tapetum) is essential for generating male gametes. Here, we report the characterization of a T-DNA insertional mutant in the Wax-deficient anther1 (Wda1) gene of rice (Oryza sativa), which shows significant defects in the biosynthesis of very-long-chain fatty acids in both layers. This gene is strongly expressed in the epidermal cells of anthers. Scanning electron microscopy analyses showed that epicuticular wax crystals were absent in the outer layer of the anther and that microspore development was severely retarded and finally disrupted as a result of defective pollen exine formation in the mutant anthers. These biochemical and developmental defects in tapetum found in wda1 mutants are earlier events than those in other male-sterile mutants, which showed defects of lipidic molecules in exine. Our findings provide new insights into the biochemical and developmental aspects of the role of waxes in microspore exine development in the tapetum as well as the role of epicuticular waxes in anther expansion.

Amino Acid Sequence↗

PubMed2006

The rice heterochronic gene SUPERNUMERARY BRACT regulates the transition from spikelet meristem to floral meristem.

Regulating the transition of meristem identity is a critical step in reproductive development. After the shoot apical meristem (SAM) acquires inflorescence meristem identity, it goes through a sequential transition to second- and higher-order meristems that can eventually give rise to floral organs. Despite ample information on the molecular mechanisms that control the transition from SAM to inflorescence meristems, little is known about the mechanism for inflorescence development, especially in monocots. Here, we report the identification of the SUPERNUMERARY BRACT (SNB) gene controlling the transition from spikelet meristem to floral meristem and the floral organ development. This gene encodes a putative transcription factor carrying two AP2 domains. The SNB:GFP fusion protein is localized to the nucleus. SNB is expressed in all the examined tissues, but most strongly in the newly emerging spikelet meristems. In SNB knockout plants, the transition from spikelet meristems to floral meristems is delayed, resulting in the production of multiple rudimentary glumes in an alternative phyllotaxy. The development of additional bracts interferes with subsequent floral architecture. In some spikelets, the empty glumes and lodicules are transformed into lemma/palea-like organs. Occasionally, the number of stamens and carpels is altered and an ectopic floret occurs in the axil of the rachilla. These phenotypes suggest that snb is a heterochronic mutant, affecting the phase transition of spikelet meristems, the pattern formation of floral organs and spikelet meristem determinancy.

Amino Acid Sequence↗

PubMed2006

Identification of active transposon dTok, a member of the hAT family, in rice.

Recent completion of the sequencing of the rice genome has revealed that it contains >40% repetitive sequences, most of which are related to inactive transposable elements. During the molecular analysis of the floral organ number 1/multiple pistil 2 (fon1/mp2) mutant, we identified an active transposable element dTok0 that was inserted at the kinase domain of FON1, a homolog of CLAVATA1. Insertion of the element into FON1 generated an 8 bp duplication of its target sites, which is one of the major characteristics of the hAT family of transposons. The dTok0 element was actively transposed out of the FON1 gene, leaving 5-8 bp footprints. Reinsertion into a new location was observed at a low frequency. Analysis of the genome sequence showed that the rice cultivar 'Nipponbare' contains 25 copies of dTok elements; similar numbers were present in all the Oryza species examined. Because dTok0 does not encode a transposase, enzyme activity should be provided in trans. We identified a putative autonomous transposon, Tok1 that contains an intact open reading frame of the Ac-like transposase.

Alleles↗

PubMed2006

Rice Immature Pollen 1 (RIP1) is a regulator of late pollen development.

We isolated a pollen-preferential gene, RICE IMMATURE POLLEN 1 (RIP1), from a T-DNA insertional population of japonica rice that was trapped by a promoterless beta-glucuronidase (GUS) gene. Semi-quantitative reverse transcription-PCR (RT-PCR) analyses confirmed that the RIP1 transcript was abundant at the late stages of pollen development. Transgenic plants carrying a T-DNA insertion in the RIP1 gene displayed the phenotype of segregation distortion of the mutated rip1 gene. Moreover, rip1/rip1 homozygous progeny were not present. Reciprocal crosses between Rip1/rip1 heterozygous plants and the wild type showed that the rip1 allele could not be transmitted through the male. Microscopic analysis demonstrated that development in the rip1 pollen was delayed, starting at the early vacuolated stage. Close examination of that pollen by transmission electron microscopy also showed delayed formation of starch granules and the intine layer. In addition, development of the mitochondria, Golgi apparatus, lipid bodies, plastids and endoplasmic reticulum was deferred in the mutant pollen. Under in vitro conditions, germination of this mutant pollen did not occur, whereas the rate for wild-type pollen was >90%. These results indicate that RIP1 is necessary for pollen maturation and germination. This gene encodes a protein that shares significant homology with a group of proteins containing five WD40 repeat sequences. The green fluorescent protein (GFP)-RIP1 fusion protein is localized to the nucleus. Therefore, RIP1 is probably a nuclear protein that may form a functional complex with other proteins and carry out essential cellular and developmental roles during the late stage of pollen formation.

Amino Acid Motifs↗

PubMed2006

Structure, expression, and functional analysis of the hexokinase gene family in rice (Oryza sativa L.).

Hexokinase (HXK) is a dual-function enzyme that both phosphorylates hexose to form hexose 6-phosphate and plays an important role in sugar sensing and signaling. To investigate the roles of hexokinases in rice growth and development, we analyzed rice sequence databases and isolated ten rice hexokinase cDNAs, OsHXK1 (Oryza sativa Hexokinase 1) through OsHXK10. With the exception of the single-exon gene OsHXK1, the OsHXKs all have a highly conserved genomic structure consisting of nine exons and eight introns. Gene expression profiling revealed that OsHXK2 through OsHXK9 are expressed ubiquitously in various organs, whereas OsHXK10 expression is pollen-specific. Sugars induced the expression of three OsHXKs, OsHXK2, OsHXK5, and OsHXK6, in excised leaves, while suppressing OsHXK7 expression in excised leaves and immature seeds. The hexokinase activity of the OsHXKs was confirmed by functional complementation of the hexokinase-deficient yeast strain YSH7.4-3C (hxk1, hxk2, glk1). OsHXK4 was able to complement this mutant only after the chloroplast-transit peptide was removed. The subcellular localization of OsHXK4 and OsHXK7, observed with green fluorescent protein (GFP) fusion constructs, indicated that OsHXK4 is a plastid-stroma-targeted hexokinase while OsHXK7 localizes to the cytosol.

Chromosome Mapping↗

PubMed2006

The rice FON1 gene controls vegetative and reproductive development by regulating shoot apical meristem size.

Most plant organs develop from meristems. Rice FON1, which is an ortholog of Clv1, regulates stem cell proliferation and organ initiation. The point muta-tions, fon1-1 and fon1-2, disrupt meristem balance, resulting in alteration of floral organ numbers and the architecture of primary rachis branches. In this study, we identified two knockout alleles, fon1-3 and fon1-4, generated by T-DNA and Tos17 insertion, respectively. Unlike the previously isolated point mutants, the null mutants have alterations not only of the reproductive organs but also of vegetative tissues, producing fewer tillers and secondary rachis branches. The mutant plants are semi-dwarfs due to delayed leaf emergence, and leaf senescence is delayed. SEM analysis showed that the shoot apical meristems of fon1-3 mutants are enlarged. These results indicate that FON1 controls vegetative as well as reproductive development by regulating meristem size.

Aging↗

PubMed2006

Generation of a flanking sequence-tag database for activation-tagging lines in japonica rice.

We have generated 47,932 T-DNA tag lines in japonica rice using activation-tagging vectors that contain tetramerized 35S enhancer sequences. To facilitate use of those lines, we isolated the genomic sequences flanking the inserted T-DNA via inverse polymerase chain reaction. For most of the lines, we performed four sets of amplifications using two different restriction enzymes toward both directions. In analyzing 41,234 lines, we obtained 27,621 flanking sequence tags (FSTs), among which 12,505 were integrated into genic regions and 15,116 into intergenic regions. Mapping of the FSTs on chromosomes revealed that T-DNA integration frequency was generally proportional to chromosome size. However, T-DNA insertions were non-uniformly distributed on each chromosome: higher at the distal ends and lower in regions close to the centromeres. In addition, several regions showed extreme peaks and valleys of insertion frequency, suggesting hot and cold spots for T-DNA integration. The density of insertion events was somewhat correlated with expressed, rather than predicted, gene density along each chromosome. Analyses of expression patterns near the inserted enhancer showed that at least half the test lines displayed greater expression of the tagged genes. Whereas in most of the increased lines expression patterns after activation were similar to those in the wild type, thereby maintaining the endogenous patterns, the remaining lines showed changes in expression in the activation tagged lines. In this case, ectopic expression was most frequently observed in mature leaves. Currently, the database can be searched with the gene locus number or location on the chromosome at http://www.postech.ac.kr/life/pfg/risd. On request, seeds of the T(1) or T(2) plants will be provided to the scientific community.

Chromosome Mapping↗

PubMed2006

Transgenic rice lines expressing maize C1 and R-S regulatory genes produce various flavonoids in the endosperm.

Flavonoids, compounds that possess diverse health-promoting benefits, are lacking in the endosperm of rice. Therefore, to develop transgenic lines that produce flavonoids, we transformed a white rice cultivar, Oryza sativa japonica cv. Hwa-Young, with maize C1 and R-S regulatory genes. Expression of these transgenes was restricted to the endosperm using the promoter of a rice prolamin gene. The pericarp of the C1/R-S homozygous lines became dark brown in accordance with their maternal genotype, whereas the endosperm turned chalky, similar to the opaque kernel phenotype. Analysis via high-performance liquid chromatography (HPLC) revealed that numerous kinds of flavonoids were produced in these transgenic kernels. To identify individual flavonoids, the number of HPLC peaks was reduced through moderate acid hydrolysis, followed by ethyl acetate partitioning. Amongst the major flavonoids, dihydroquercetin (taxifolin), dihydroisorhamnetin (3'-O-methyl taxifolin) and 3'-O-methyl quercetin were identified through liquid chromatography/mass spectrometry/mass spectrometry and nuclear magnetic resonance analyses. Fluorescence labelling with diphenylboric acid showed that the flavonoids were highly concentrated in the cells of four to five outer endosperm layers. More importantly, a high fluorescence signal was present in the cytosol of the inner endosperm layers. However, the overall signal in the inner layers was significantly lower because starch granules and protein bodies occupied most of the cytosolic space. Our estimate of the total flavonoid content in the transgenic kernels suggests that C1/R-S rice has the potential to be developed further as a novel variety that can produce various flavonoids in its endosperm.

Chromatography, High Pressure Liquid↗

PubMed2005

Characterization of rice mutants with enhanced susceptibility to rice blast.

As a first step towards identifying genes involving in the signal transduction pathways mediating rice blast resistance, we isolated 3 mutants lines that showed enhanced susceptibility to rice blast KJ105 (91-033) from a T-DNA insertion library of the japonica rice cultivar, Hwayeong. Since none of the susceptible phenotypes co-segregated with the T-DNA insertion we adapted a map-based cloning strategy to isolate the gene(s) responsible for the enhanced susceptibility of the Hwayeong mutants. A genetic mapping population was produced by crossing the resistant wild type Hwayeong with the susceptible cultivar, Nagdong. Chi-square analysis of the F2 segregating population indicated that resistance in Hwayeong was controlled by a single major gene that we tentatively named Pi-hy. Randomly selected susceptible plants in the F2 population were used to build an initial map of Pi-hy. The SSLP marker RM2265 on chromosome 2 was closely linked to resistance. High resolution mapping using 105 F2 plants revealed that the resistance gene was tightly linked, or identical, to Pib, a resistance gene with a nucleotide binding sequence and leucine-rich repeats (NB-LRR) previously isolated. Sequence analysis of the Pib locus amplified from three susceptible mutants revealed lesions within this gene, demonstrating that the Pi-hy gene is Pib. The Pib mutations in 1D-22-10-13, 1D-54-16-8, and 1C-143-16-1 were, respectively, a missense mutation in the conserved NB domain 3, a nonsense mutation in the 5th LRR, and a nonsense mutation in the C terminus following the LRRs that causes a small deletion of the C terminus. These findings provide evidence that NB domain 3 and the C terminus are required for full activity of the plant R gene. They also suggest that alterations of the resistance gene can cause major differences in pathogen specificity by affecting interactions with an avirulence factor.

Carrier Proteins↗

PubMed2005

Functional diversification of the two C-class MADS box genes OSMADS3 and OSMADS58 in Oryza sativa.

The C-class MADS box gene AGAMOUS (AG) plays crucial roles in Arabidopsis thaliana development by regulating the organ identity of stamens and carpels, the repression of A-class genes, and floral meristem determinacy. To examine the conservation and diversification of C-class gene function in monocots, we analyzed two C-class genes in rice (Oryza sativa), OSMADS3 and OSMADS58, which may have arisen by gene duplication before divergence of rice and maize (Zea mays). A knockout line of OSMADS3, in which the gene is disrupted by T-DNA insertion, shows homeotic transformation of stamens into lodicules and ectopic development of lodicules in the second whorl near the palea where lodicules do not form in the wild type but carpels develop almost normally. By contrast, RNA-silenced lines of OSMADS58 develop astonishing flowers that reiterate a set of floral organs, including lodicules, stamens, and carpel-like organs, suggesting that determinacy of the floral meristem is severely affected. These results suggest that the two C-class genes have been partially subfunctionalized during rice evolution (i.e., the functions regulated by AG have been partially partitioned into two paralogous genes, OSMADS3 and OSMADS58, which were produced by a recent gene duplication event in plant evolution).

Amino Acid Sequence↗

PubMed2005

Characterization and transcriptional expression of the alpha-expansin gene family in rice.

The rice genome contains at least 28 EXPA (alpha-expansin) genes. We have obtained near full-length cDNAs from the previously uncharacterized genes. Analysis of these newly identified clones together with the 12 identified earlier showed that the EXPA genes contain up to two introns and encode proteins of 240 to 291 amino acid residues. The EXPA proteins contain three conserved motifs: eight cysteine residues at the N-terminus, four tryptophan residues at the C-terminus, and a histidine-phenylalanine-aspartate motif in the central region. EXPA proteins could be divided into six groups based on their sequence similarity. Most were strongly induced in two-day-old seedlings and in the roots of one-week-old plants. However, only 14 genes were expressed in the aboveground organs, and their patterns were quite diverse. Transcript levels of EXPA7, 14, 15, 18, 21, and 29 were greater in stems, while EXPA2, 4, 5, 6, and 16 were highly expressed in both stem and sheath but not in leaf blade. EXPA1 is leaf blade-preferential, and EXP9 is leaf sheath-preferential. Most of the root-expressed genes were more strongly expressed in the dividing zone. However, the Group 2 EXPA genes were also strongly expressed in both mature and dividing zones, while EXPA9 was preferentially expressed in the elongation zone. Fourteen EXPA genes were expressed in developing panicles, with some being expressed during most developmental stages, others only as the panicles matured. These diverse expression patterns of EXPA genes suggest that in general they have distinct roles in plant growth and development.

DNA, Complementary↗

PubMed2005

Rice Undeveloped Tapetum1 is a major regulator of early tapetum development.

The tapetum, the innermost of four sporophytic layers in the anther wall, comes in direct contact with the developing male gametophyte and is thought to play a crucial role in the development and maturation of microspores. Here, we report the identification of rice (Oryza sativa) Undeveloped Tapetum1 (Udt1), which is required for the differentiation of secondary parietal cells to mature tapetal cells. T-DNA or retrotransposon Tos17 insertions in the Udt1 gene caused male sterility. The anther walls and meiocytes of the mutants were normal during the early premeiosis stage, but their tapeta failed to differentiate and became vacuolated during the meiotic stage. In addition, meiocytes did not develop to microspores, and middle layer degeneration was inhibited. Consequently, the anther locules contained no pollen. The UDT1:green fluorescent protein fusion protein was localized to the nucleus. This, together with its homology with other basic helix-loop-helix proteins, suggests that UDT1 is a transcription factor. DNA microarray analysis identified 958 downregulated and 267 upregulated genes in the udt1-1 anthers, suggesting that Udt1 plays a major role in maintaining tapetum development, starting in early meiosis.

Basic Helix-Loop-Helix Leucine Zipper Transcriptio↗

PubMed2005

Characterization of an abiotic stress-inducible dehydrin gene, OsDhn1, in rice (Oryza sativa L.).

A full-length 1.1 kb cDNA, designated Oryza sativa Dehydrin 1 (OsDhn1), was isolated from the seed coat of rice. The deduced protein is hydrophilic and has three K-type and one S-type motifs (SK3-type), indicating that OsDhn1 belongs to the acidic dehydrin family, which includes wheat WCOR410 and Arabidopsis COR47. Expression of OsDhn1 was strongly induced by low temperature as well as by drought. Induction of OsDhn1 by cold stress was clearcut in the roots of seedlings and the epidermis of palea and lemma. OsDhn1 was also up-regulated in UBI::CBF1/DREB1b transgenic plants indicating that it is regulated by the CBF/DREB stress signaling pathway.

Amino Acid Sequence↗

PubMed2005

Molecular cloning and expression analysis of the cell-wall invertase gene family in rice (Oryza sativa L.).

Cell-wall invertase (CIN) catalyzes the hydrolysis of sucrose into glucose and fructose for the supply of carbohydrates to sink organs via an apoplastic pathway. To study the CIN genes in rice (Oryza sativa L.), we isolated cDNA clones showing amino acid similarity to the plant cell wall invertase proteins from a search of rice sequence databases. Profile analyses revealed that the cloned genes are expressed in unique patterns in various organs. For example, transcripts of OsCIN1, OsCIN2, OsCIN4, and OsCIN7 were detected in immature seeds whereas OsCIN3 gene expression was flower-specific. Further transcript analysis of these genes expressed in developing seeds indicated that OsCIN1, OsCIN2, and OsCIN7 might play an important role involving sucrose partitioning to the embryo and endosperm. Sucrose, a substrate of CINs, induced the accumulation of OsCIN1 transcripts in excised leaves and OsCIN2 in immature seeds, while the level of OsCIN5 was significantly down-regulated in excised leaves treated with sucrose. Infecting the tissues with rice blast (Magnaporthe grisea) as a biotic stressor increased the expression of OsCIN1, OsCIN4, and OsCIN5, suggesting that these genes may participate in a switch in metabolism to resist pathogen invasion. These results demonstrate that OsCIN genes play diverse roles involving the regulation of metabolism, growth, development, and stress responses.

Cell Wall↗

PubMed2005

Morphological alterations by ectopic expression of the rice OsMADS4 gene in tobacco plants.

OsMADS4, a rice MADS-box gene, is a member of the GLO/PI family that specifies the identity of petals and stamens in combination with other MADS-box genes. We report here the ectopic expression of OsMADS4 fused to the CaMV 35S promoter in tobacco plants. Transgenic plants carrying the CaMV 35S promoter::OsMADS4 construct generated mutant flowers with a mosaic carpel, in which the tissue around the nectary was elongated and the styles reduced. The fruits were distorted, but viable seeds did develop. These phenotypes mimicked those of transgenic tobacco plants that ectopically express Antirrhinum GLO. However, unlike GLO, OsMADS4 did not cause any homeotic change in the first whorl of the transgenic flowers. These results suggest that the functional role of OsMADS4 in the outer whorls has diverged from that of its dicot counterparts.

Flowers↗