PubMed Health⌕ Search

Biomedical subjects

H B Tanowitz

Publications and source records attributed to H B Tanowitz.

At least 73 records · Page 4Linked to original sources

Chagas' disease.

Chagas' disease, caused by Trypanosoma cruzi, is an important cause of morbidity in many countries in Latin America. The important modes of transmission are by the bite of the reduviid bug and blood transfusion. The organism exists in three morphological forms: trypomastigotes, amastigotes, and epimastigotes. The mechanism of transformation and differentiation is currently being explored, and signal transduction pathways of the parasites may be involved in this process. Parasite adherence to and invasion of host cells is a complex process involving complement, phospholipase, penetrin, neuraminidase, and hemolysin. Two clinical forms of the disease are recognized, acute and chronic. During the acute stage pathological damage is related to the presence of the parasite, whereas in the chronic stage few parasites are found. In recent years the roles of tumor necrosis factor, gamma interferon, and the interleukins in the pathogenesis of this infection have been reported. The common manifestations of chronic cardiomyopathy are arrhythmias and thromboembolic events. Autoimmune, neurogenic, and microvascular factors may be important in the pathogenesis of the cardiomyopathy. The gastrointestinal tract is another important target, and "mega syndromes" are common manifestations. The diagnosis and treatment of this infection are active areas of investigation. New serological and molecular biological techniques have improved the diagnosis of chronic infection. Exacerbations of T. cruzi infection have been reported for patients receiving immuno-suppressive therapy and for those with AIDS.

Animals↗

Gap junction distribution is altered between cardiac myocytes infected with Trypanosoma cruzi.

Conduction disturbances frequently accompany both acute and chronic Chagas' disease. To explore the possibility that changes in gap junction distribution or abundance might play a role in these disturbances, we have investigated intercellular communication between rat neonatal cardiac myocytes in cultures infected with Trypanosoma cruzi. Contractile activity of infected cells was characterized by regional asynchrony within the culture as well as by irregular contraction patterns. Junctional conductance between infected cell pairs was found to be significantly lower than in uninfected cell pairs, and the rapidity and extent of intercellular transfer of the dye lucifer yellow was markedly reduced between infected cells. Immunocytochemical studies demonstrated that the parasitic infection significantly decreased connexin43 expression at junctional membrane regions, correlating with the detected functional uncoupling. These findings of reduced gap junction abundance and function in trypanosome-infected cells may provide important insight into the pathogenesis of the cardiac arrhythmias that attend Chagas' disease.

Animals↗

Pyrimethamine concentrations in serum during treatment of acute murine experimental toxoplasmosis.

Central nervous system toxoplasmosis is a major opportunistic infection in patients with acquired immunodeficiency syndrome. The standard therapy for this infection is pyrimethamine (PYR) and sulfonamides. To assess in vivo if PYR alone could adequately treat toxoplasmosis, a murine model of acute toxoplasmosis was used. The CD1 strain of mice was infected intraperitoneally with 10(4) parasites of the RH strain of Toxoplasma gondii. Pyrimethamine was administered in mouse chow at concentrations of 0, 0.03125, 0.0625, 0.125, 0.25, or 1.0 mg of PYR/g of food, which provides the following daily PYR dosages: 0, 6.25, 12.5, 25, 50, and 200 mg/kg/day. No sulfonamides were administered. Serum PYR levels proved more accurate than mg of PYR/g of food in predicting survival. Mice with serum PYR levels greater than or equal to 500 ng/ml (2 microM) survived and had no parasites present on peritoneal lavage. Mice with serum PYR levels less than 100 ng/ml (0.4 microM) had a 100% mortality rate and the average parasite count was 3 x 10(7) organisms in the lavage fluid. At a PYR level of 370 ng/ml, six of 11 mice survived and the lavage fluid contained 2.5 x 10(5) organisms. Previously, using 3H-uracil in an in vitro assay, PYR at a concentration of 500 ng/ml was shown to be as effective in inhibiting Toxoplasma growth as the combination of PYR (100 ng/ml) and sulfonamides 25 micrograms/ml). These data suggest the potential usefulness of PYR for monotherapy of toxoplasmosis and are consistent with previously described in vitro assays.

Acute Disease↗

Blastocystis hominis in hospital employees.

Several reports have appeared that either support or deny the importance of the protozoan Blastocystis hominis as an intestinal pathogen in humans. In this report, we describe the clinical characteristics of B. hominis and its response to therapy in hospital employees found to have the parasite on routine screening of stools. During the study, 49 patients with B. hominis were identified, and 413 stools were examined from these patients. Twenty-nine patients were asymptomatic (59%), and 20 had symptoms of bloating, flatulence, soft/loose stools, or constipation. Of these 20 patients, 10 had symptoms that correlated with the presence or absence of B. hominis, four had symptoms that were independent of B. homonis, and six had other intestinal parasites that could account for their symptoms. Nineteen percent of patients without treatment had eradication of B. hominis from stool on follow-up examination. Metronidazole did not increase this rate. Iodoquinol treatment eradicated the organism in 41% of patients (p less than 0.05), and resulted in the reduction or eradication of the parasite in 62%, as determined by follow-up examination.

Adolescent↗

Medical management of AIDS patients. Gastrointestinal manifestations.

Gastrointestinal manifestations of AIDS are common. Opportunistic infections and tumors may affect any portion of the GI tract from oral cavity to anus. Esophageal involvement may result from Candida, CMV, HSV, HIV, and tumors. Biliary tract and pancreatic disease may cause abdominal pain. Diarrhea occurs in over 50% of AIDS patients and is multifactorial.

Abdominal Pain↗

Light microscopic diagnosis of human microsporidiosis and variable response to octreotide.

Microsporida are protozoan parasites that have recently been identified as a cause of human disease in immunocompromised patients. Because of their small size, they have been recognized primarily by electron microscopy. This has limited the study of their prevalence, incidence, and association with large-volume diarrhea. The present report describes two cases of Enterocytozoon bieneusi infection of the small intestine in patients with intractable diarrhea in whom the diagnosis was made by light microscopy and confirmed by electron microscopy. Both patients were treated with octreotide, and one had a good response.

Acquired Immunodeficiency Syndrome↗

Modulation of host cell metabolism by Trypanosoma cruzi.

Chagas disease, caused by the hemoflagellate Trypanosoma cruzi, is a complicated and devastating disease. It is hypothesized that an important target of infection may be the endothelial cell and that both the acute and chronic forms of the disease involve abnormalities in the microcirculation. Stephen Morris and colleagues suggest that endothelial cell dysfunction occurs as a consequence of amastigote-associated interference in host cell metabolism.

Journal Article↗

Sensitive and specific detection of toxoplasma DNA in an experimental murine model: use of Toxoplasma gondii-specific cDNA and the polymerase chain reaction.

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.

Animals↗

Resolution of Cryptosporidium infection in an AIDS patient after improvement of nutritional and immune status with octreotide.

An AIDS patient with severe large volume diarrhea and malnutrition due to cryptosporidial infection is presented. The patient, who was not receiving zidovudine, was treated with octreotide with resolution of diarrhea leading to improvement in nutritional status, immune functions, and subsequently, resolution of the Cryptosporidium infection. This case points out the need for adequate nutrition in AIDS patients and highlights the relationship of nutrition and the immune system.

Acquired Immunodeficiency Syndrome↗

Disseminated strongyloidiasis with central nervous system involvement diagnosed antemortem in a patient with acquired immunodeficiency syndrome and Burkitts lymphoma.

A 45-year-old man presented with central nervous system involvement as the initial manifestation of disseminated infection with Strongyloides stercoralis. Several concurrent clinical factors contributed to this event, all related to the patient's immunosuppression, including high-grade lymphoma, corticosteroid therapy, and acquired immunodeficiency syndrome. This is only the third case of CNS involvement in disseminated strongyloidiasis diagnosed antemortem.

Acquired Immunodeficiency Syndrome↗

Extracellular matrix derived from Trypanosoma cruzi infected endothelial cells directs phenotypic expression.

Infection of confluent human umbilical vein endothelial cells by the parasite Trypanosoma cruzi results in the appearance of an altered heparan sulfate proteoglycan (HSPG) isolated from the extracellular matrix of infected endothelial cells (ECMi). HSPG from ECMi differed from HSPG obtained from the extracellular matrix of uninfected endothelial cells (ECMu) by virtue of an 8-10-fold increase in sulfation and a different elution pattern using DEAE Sepharose chromatography. Analysis of the HSPG that binds to acidic fibroblast growth factor (aFGF) revealed that infection increased the proportion of HSPG that binds to aFGF by 35%. Heparitinase and alkaline borohydride treatment of aFGF-binding HSPG and chromatographic resolution on Sepharose CL4B column revealed an infection-associated 10-fold increase in sulfation of the GAG side chain with no significant change in the migration of the core protein. In addition, the aFGF binding HSPG isolated from ECMi demonstrated a markedly attenuated synergistic mitogenic activity with aFGF in a cell proliferation assay. All of the infection associated changes in HSPG could be demonstrated in HSPG obtained from uninfected endothelial cell cultures grown on ECMi. Hence, the ECMi is associated with signals capable of modulating the ECM associated metabolism of uninfected endothelial cells. This facility of ECMi was also shown to extend to patterns of Gs protein synthesis as revealed by Western blot analysis. The observation that the ECM produced by infected endothelial cells can direct the synthetic patterns of uninfected endothelial cells in a manner uniquely observed in infected endothelial cells suggests a plausible pathway by which infection of only a few cells can ultimately result in the coordinate responses of neighboring uninfected cells.

Chagas Disease↗

Pathophysiological insights into the cardiomyopathy of Chagas' disease.

The evidence gained from both human and animal studies of chronic chagasic cardiomyopathy suggests that the disease occurs as a consequence of several discrete and progressive pathophysiological processes occurring after infection, the ultimate expression of which depends on a host of unidentified factors. Collectively, the infection-associated events compromise microvasculature function and result in hypoperfusion, with consequences indistinguishable from those observed in other, nonparasitological cardiomyopathic diseases secondary to hypoperfusion. Therefore, chronic chagasic cardiomyopathy may share similar pathophysiological abnormalities with other chronic congestive cardiomyopathic states.

Animals↗

Enhanced platelet adherence and aggregation in Chagas' disease: a potential pathogenic mechanism for cardiomyopathy.

Spasm and thrombosis of the coronary microcirculation has been implicated in the pathogenesis of the cardiomyopathy of Chagas' disease. We demonstrate that increases in platelet adherence and aggregation accompany Trypanosoma cruzi infection and may contribute to the observed microvascular pathology. Scanning electron microscopy and radiolabeled platelets studies revealed that platelet adherence to T. cruzi-infected human endothelial cells was significantly increased when compared to controls (P = 0.024). In in vitro experiments, we determined the influence of infection on prostacyclin production, a marker of endothelial cell perturbation. The basal levels of 6-keto-prostaglandin F1 alpha was significantly greater in the supernatant of infected endothelial cells than in those of uninfected endothelial cells (P less than 0.05). The influence of infection was assessed on platelet aggregation at days 5 and 12 post-infection in A/J mice. Platelets from T. cruzi-infected mice were 2-6-fold more sensitive to aggregation induced by adenosine diphosphate and sodium arachidonate than controls. Thromboxane B2 levels in the plasma of infected mice were greater than controls. These data support the hypothesis that heightened platelet reactivity and endothelial cell dysfunction are associated with acute Chagas' disease and may cause coronary microvascular spasm and/or occlusion.

Animals↗

Trypanosoma cruzi: infection of cultured human endothelial cells alters inositol phosphate synthesis.

Infection of cultured endothelial cells with Trypanosoma cruzi alters intracellular Ca2+ homeostasis. To help understand the biochemical basis for this phenomenon, we determined the influence of infection on inositol phosphate formation in a broken cell preparation. Inositol phosphates participate in the regulation of cytosolic Ca2+. In uninfected endothelial cells, bradykinin guanosine 5'-O-thiophosphate (GTP tau S), and calcium all stimulated inositol phosphate (IP1), inositol bisphosphate (IP2), and inositol trisphosphate (IP3) formation within 5 sec of incubation. At longer periods of incubation with GTP tau S and bradykinin, formation of IP1 was linear for 30 sec, whereas the rate of IP2 and IP3 generation was maximal at 20 and 5 sec, respectively. Second, infection markedly changed these aspects of inositol phosphate generation. First, unstimulated (basal) levels of IP1 and IP3 were markedly increased over those levels in membranes of uninfected cells. Infection decreased the rate of formation for the three inositol phosphates in response to GTP tau S and bradykinin. Finally, infection diminished the magnitude of inositol phosphate synthesis in response to Ca2+ for IP1, IP2, and IP3, respectively. Studies on G proteins using cholera and pertussis toxin were carried out to determine if the infection-associated changes in inositol phosphate generation could be attributed to functional changes in these regulatory proteins known to participate in the activation of phospholipase C. Infection markedly decreased the magnitude of cholera and pertussis toxin-dependent ADP ribosylation, as compared to control uninfected cells. Incubation of uninfected endothelial cells with cholera and pertussis toxin also decreased the magnitude of cholera and pertussis toxin ADP ribosylation. Despite the similar effects of infection and toxin treatment on subsequent toxin-catalyzed ADP ribosylation, toxin treatment did not influence inositol phosphate generation. Collectively, these results demonstrate an influence of infection on receptor-dependent and -independent synthesis of inositol phosphates, possibly by an action on phospholipase C. The results help to explain the apparent infection-associated increase in basal Ca2+ previously observed and suggest that interference with signal transduction may be a consequence of the presence of the parasite.

Adenosine Diphosphate Ribose↗

Neurochemical measurements in the brains of mice infected with Trypanosoma brucei brucei (TREU 667).

Trypanosoma brucei brucei (TREU 667) infected mice were used as a model of African trypanosomiasis, a disease in which neuropsychiatric manifestations occur. To study the possible neurochemical basis of these abnormalities, we measured brain acetylcholine receptor numbers, activities of the cholinergic enzymes, choline acetyltransferase (CAT), and acetylcholinesterase (AChE), and regional concentrations of the monoamines, dopamine (DA), serotonin (5-HT), and norepinephrine (NE), and their acid metabolites, homovanillic acid (HVA), 3,4-dihydroxyphenylacetic acid (DOPAC), and 5-hydroxyindoleacetic acid (5-HIAA) in mice infected with T. b. brucei. There were no significant changes in CAT or AChE activities or acetylcholine receptor numbers at either 35 or 50 days post-infection (PI). At day 35 PI, the only significant finding was a decrease in 5-HIAA concentration in the brain stem, a change which did not persist to day 50 PI. At day 50 PI there were, however, significant increases in DA concentration in the brain stem and NE concentrations in the hippocampus, cerebellum, brain stem and striatum. To establish a chronic relapsing murine model, mice were treated with diminazene aceturate (Berenil) at day 60 PI and killed 60 days later (120 days PI). In these mice, 5-HT concentrations were significantly increased in the hypothalamus and decreased in the cortex. In addition, 5-HIAA concentrations were increased in the striatum and hypothalamus and HVA concentrations were increased in the striatum and hippocampus. Our data, taken together with that of others, suggests that there are alterations in the monoaminergic, but not in the cholinergic, neuronal system, in African trypanosomiasis. These data may form the basis for the neuropsychiatric abnormalities that are associated with this disease.

Acetylcholinesterase↗

Effect of verapamil on the development of chronic experimental Chagas' disease.

In previous work, we have shown that the chronic administration of verapamil, a calcium channel blocker, ameliorated the mortality, pathology, and biochemical alterations associated with acute murine Chagas' disease. To extend these studies to an established chronic model, C3H/Hej mice were infected with the Sylvio X10/4 clone. This clone does not cause symptomatic acute disease but does induce cardiac pathology incorporating several pathological features of human chagasic cardiomyopathy. Cardiac pathology was assessed at 60, 90, and 180 days postinfection. There was a significant decrease in the degree of inflammation and fibrosis in the group infected and treated with verapamil. Myocardial beta-adrenergic adenylate cyclase (AC) activity was determined 180 days postinfection. In the infected group not treated with verapamil, there was no significant change in the maximum rate of conversion of ATP to cAMP (Vmax) or in the concentration of agonist giving 50% of Vmax (apparent Kact) for isoproterenol (ISPN)-dependent AC activation. The increase in Vmax for ISPN determined in the presence of 5'-guanylylimidodiphosphate (Gpp[NH]p) was consistently lower in infected than in uninfected mice, suggesting that infection altered the potential synergistic activation of AC by the guanine nucleotide. In the infected group treated with verapamil, there was a slight increase in the Vmax for ISPN. However, there was a marked enhancement of the synergistic contribution of Gpp(NH)p. These observations suggest that verapamil had preserved that aspect of the AC complex mediating guanine nucleotide sensitive activation of AC. Collectively, the observations in the acute and chronic models of murine Chagas' disease suggest that verapamil may be a useful adjunct in treatment.

Adenylyl Cyclases↗