PubMed Health⌕ Search

Biomedical subjects

H Blöcker

Publications and source records attributed to H Blöcker.

At least 37 records · Page 2Linked to original sources
PubMed1990

RNA primary sequence or secondary structure in the translational initiation region controls expression of two variant interferon-beta genes in Escherichia coli.

Efficient expression in Escherichia coli (E. coli) of the human interferon-beta gene (IFN-beta) gene and of a chemically synthesized IFN-beta gene variant (506 base pairs; synIFN-beta) adapted to the E. coli codon usage, both fused to the E. coli atpE ribosome-binding site, is controlled either by primary sequence or by mRNA secondary-structure in the translational initiation region. High level expression of the natural human atpE/IFN-beta gene fusion is governed by the nucleotide composition preceding the initiator codon AUG. A single U----C exchange in the -2 or -1 position preceding the initiator codon AUG reduces the translational efficiency from 18% of total cellular protein to only 8% or 4%, respectively, while both U----C substitutions reduce IFN-beta expression below 1%. These sequence alterations interfere with efficient ribosome binding as revealed by toeprinting. They provide further evidence for the influence of the anticodon-flanking regions of tRNA(fMet) upon the initiation rate of translation. In contrast, translation of the synthetic variant atpE/synIFN-beta gene fusion is controlled by a moderately stable stem-loop structure (delta G = -4 kcal/mol; 37 degrees C) located within the coding region and overlapping the 30 S ribosomal subunit attachment site. That the stability of the hairpin interferes with the initiation of translation is inferred from site-directed mutagenesis and toeprint analyses. mRNA half-life in these variants is positively correlated with the rate of translation and involves two major endonucleolytic cleavage site 5'-upstream of the Shine-Dalgarno region.

Base Sequence↗
PubMed1990

Detection and identification of mycobacteria by amplification of rRNA.

Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

Base Sequence↗
PubMed1990

Human leukocyte elastase inhibitors: designed variants of human pancreatic secretory trypsin inhibitor (hPSTI).

Variants of human secretory trypsin inhibitor were constructed with the aim of producing inhibitors specific for human leukocyte elastase. Models of the hPSTI/HLE and hPSTI/chymotrypsin complexes were generated by computer aided protein design and used to plan better HLE inhibitors. This resulted in the production of the strongest and most specific inhibitors of HLE known.

Animals↗
PubMed1989

Probing hairpin structures of small DNAs by nondenaturing polyacrylamide gel electrophoresis.

The influence of temperature on the electrophoretic mobility of small DNAs, capable of forming hairpin structures, is investigated under nondenaturing conditions. Three series of hairpin-forming DNAs containing different numbers of thymidine, deoxyadenosine, and deoxyguanosine residues in their loop, and an identical sequence in the helical region, are analyzed. All show enhanced electrophoretic mobility if they adopt the hairpin conformation. The same quantitative relationship between hairpin formation and increase in electrophoretic mobility is observed for all of the three series. The constancy of this increase suggests a dependence of electrophoretic acceleration on the length of the helical region. A possible application of nondenaturing electrophoresis is monitoring the hairpin/coil transition. Another possible application is the detection of dimers formed by partially self-complementary sequences. This dimer formation is detected for completely complementary DNAs, whereas sequences which might form imperfect double helices, especially those with three bulged-out nucleotides, prefer hairpin formation. The possible applications are experimentally approached and discussed.

DNA↗
PubMed1989

Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA.

Using a set of synthetic oligonucleotides homologous to broadly conserved sequences in-vitro amplification via the polymerase chain reaction followed by direct sequencing results in almost complete nucleotide determination of a gene coding for 16S ribosomal RNA. As a model system the nucleotide sequence of the 16S rRNA gene of M.kansasii was determined and found to be 98.7% homologous to that of M.bovis BCG. This is the first report on a contiguous sequence information of an entire amplified gene spanning 1.5 kb without any subcloning procedures.

Bacteria↗
PubMed1989

Cloning, sequencing and expression in Escherichia coli of the D-2-hydroxyisocaproate dehydrogenase gene of Lactobacillus casei.

D-2-Hydroxyisocaproic acid dehydrogenase (D-HicDH) from Lactobacillus casei was purified and partially sequenced. A 65-mer oligodeoxyribonucleotide probe corresponding to the N-terminal 23 amino acids was synthesized and a physical map was made of the genomic region which hybridized most strongly. A strongly hybridising restriction fragment was highly purified and eventually cloned at low frequency in pBR322. The original clones spontaneously produced D-HicDH at about 0.05% of total protein and showed viability problems in that 10- to 12-h growth-lag periods occurred after diluting stationary cultures into fresh medium. Subcloning into pGEM3 plasmids for sequencing with concomitant ExoIII deletion led to clones which no longer exhibited the growth inhibition characteristics but now made D-HicDH as 3 to 5% of total protein. Subcloning downstream from a double PL PR promoter in plasmid pJLA601 gave a highly inducible clone that builds large inclusion bodies of largely denatured D-HicDH. The gene transcript was mapped for L. casei and Escherichia coli hosts. The promoter, terminator and Shine-Dalgarno sequence are functional in both organisms. The gene encodes a protein subunit of 38 kDa, whereby 67% of the sequence could be checked by correlation with partial peptide sequences from the original enzyme. So far no Lactobacillus gene has been found to utilize the Arg codons AGG and AGA.

Alcohol Oxidoreductases↗
PubMed1989

Expression of human parathyroid hormone in Escherichia coli.

Human parathyroid hormone (PTH) has been expressed in Escherichia coli as a cro-beta-galactosidase-hPTH fusion protein under temperature-sensitive control of the lambda phage PR promoter. The lacZ gene has been truncated to a different extent revealing an optimal length of the prokaryotic peptide portion between 199 and 407 amino acid residues. Up to 250 mg of pure fusion protein have been obtained from 1-liter E. coli culture by stepwise solubilization with urea. The linkage between the prokaryotic and the eukaryotic protein moiety consists of an Asp-Pro peptide bond and therefore is easily cleavable by acid treatment. A simple procedure for the purification of the hormone is described. The resulting recombinant hormone reacts with anti-PTH antibodies and stimulates renal adenylate cyclase identically to bovine or human PTH.

Adenylyl Cyclases↗
PubMed1989

Cloning, sequencing and expression of a sialidase gene from Clostridium sordellii G12.

A 4.3 kb XbaI restriction fragment of DNA from Clostridium sordellii G12 hybridized with a synthetic oligonucleotide representing the N-terminus of the sialidase protein secreted by C. sordellii. This cloned fragment was shown to encode only part of the sialidase protein. The sialidase gene of C. sordellii was completed by a 0.7 kb RsaI restriction fragment overlapping one end of the XbaI fragment. After combining the two fragments and transformation of Escherichia coli, a clone that expressed sialidase was obtained. The nucleotide sequence of the sialidase gene of C. sordellii G12 was determined. The sequence of the 18 N-terminal amino acids of the purified extracellular enzyme perfectly matched the predicted amino acid sequence near the beginning of the structural gene. The amino acid sequence derived from the complete gene corresponds to a protein with a molecular mass of 44,735 Da. Upstream from the putative ATG initiation codon, ribosomal-binding site and promoter-like consensus sequences were found. The encoded protein has a leader sequence of 27 amino acids. The enzyme expressed in E. coli has similar properties to the enzyme isolated from C. sordellii, except for small differences in size and isoelectric point. Significant homology (70%) was found with a sialidase gene from C. perfringens.

Amino Acid Sequence↗
PubMed1988

Interaction of DNA hairpin loops and a complementary strand by a triplet of base pairs.

Hypothesis of non-enzymatic recognition of primordial tRNA and mRNA precursors is experimentally approached. DNA hairpins containing a different number of deoxyguanosine residues in the loop are analyzed for their binding ability to a chemically fixed single-strand of oligo(dC). In presence of small Mg2+ concentration a hairpin with five dG residues in the loop is adsorbed to affinity matrix. Comparison of elution temperatures of hairpin oligonucleotides with those of single-stranded oligoguanylic acids with length of the loop indicates, that smallest loop able to bind forms a triplet of base pairs.

Adsorption↗
PubMed1988

Human pancreatic secretory trypsin inhibitor (PSTI) produced in active form and secreted from Escherichia coli.

As a basis for a protein design project, we decided to produce the human pancreatic secretory trypsin inhibitor (PSTI) in its active form. Total gene synthesis was carried out efficiently by (i) computer design of the gene fragments, (ii) synthesis of the oligodeoxynucleotides by the segmental support method, and (iii) assembly of double strands under optimized ligation conditions. Fusion to the ompA gene signal peptide led to secretion of processed PSTI in various constructions, with or without additional amino acids (aa) at the N-terminus. The secreted proteins (56 to 63 aa) were biologically active, suggesting that the three cysteine bridges were correctly formed. Surprisingly, after induction the product was found almost exclusively in the culture medium. Variants of PSTI with Asp or Asn at aa positions 21 and 29 [sequences published by Greene et al., Methods Enzymol. (1976) 813-825, and by Yamamoto et al., Biochem. Biophys. Res. Commun. (1985) 605-612] showed the same Ki for both human and porcine trypsin.

Amino Acid Sequence↗
PubMed1988

Three-dimensional structure of d(GGGATCCC) in the crystalline state.

The structure of the self-complementary octamer d(GGGATCCC) has been analysed by single crystal X-ray diffraction methods at a nominal resolution of 2.5 A. With acceptable stereochemistry of the model the crystallographic R factor was 16.6% after restrained least-squares refinement. In the crystal, d(GGGATCCC) forms an A-DNA double helix with slightly varying conformation of the two strands. The average displacement of the base pairs from the helix axis is unusually large and is accompanied by pronounced sliding of the base pairs along their long axes at all dinucleotide steps except for the central AT. With 12 base pairs per complete turn the helix is considerably underwound. As observed with most oligodeoxyribonucleotides analysed by X-ray crystallography so far, the octamer displays reduced base pair tilt, increased rise per base pair and a more open major groove compared with canonical A-DNA. We propose that, based on these parameters, three A-helical sub-families may be defined; d(GGGATCCC) then is a representative of the class with intermediate tilt, rise, and major groove width.

DNA↗
PubMed1988

Expression of the chemically synthesized gene for ribonuclease T1 in Escherichia coli using a secretion cloning vector.

The gene for ribonuclease T1 from Aspergillus oryzae has been chemically synthesized using the segmental support technique. An Escherichia coli clone producing the ribonuclease at high levels was constructed by linking the gene downstream to the region coding for the signal peptide of the OmpA protein (a major outer membrane protein of E. coli), using the secretion cloning vector pIN-III-ompA2. This strategy was employed in order to circumvent a possible toxic effect of the gene product on the host cell. Active ribonuclease containing four additional amino acids at the N-terminus could be isolated from the periplasmic fraction of the host. The final yield after purification was 20 mg enzyme/l liquid culture. With respect to immunological, catalytic and specific behaviour, no qualitative differences could be detected between the enzyme from the over-producing E. coli strain and ribonuclease T1 isolated from A. oryzae.

Aspergillus↗
PubMed1988

Complete synthesis and transcription in vitro of a gene coding for human ribosomal 5S RNA.

The gene coding for the major human ribosomal 5S RNA was chemically synthesized and cloned into a pUC13 vector. This approach was taken, because attempts to isolate the human 5S gene have thus far yielded either pseudogenes or variant 5S genes of unknown function. The synthetic human gene was transcribed by RNA polymerase III either in a crude HeLa cell extract or in a system reconstituted from partially purified transcription factors. Comparative studies with the Xenopus laevis somatic 5S gene show that the human gene is transcribed with similar fidelity and an efficiency of about 80% under optimal conditions. The time-course of transcription and optimal concentrations of template and transcription factors were found to be similar for both genes studied. The synthetic gene described may prove useful to study its interaction with human transcription factors in a homologous system.

Animals↗
PubMed1988

Site-specific recombination in bacteriophage Mu: characterization of binding sites for the DNA invertase Gin.

Site-specific DNA inversion in phage Mu is catalysed by the phage-encoded DNA invertase Gin and a host factor FIS. We demonstrate that purified Gin protein binds specifically to 34-bp sequences that flank the G segment as inverted repeats. Each inverted repeat (IR) contains two binding sites for Gin which have to be arranged in a specific configuration to constitute a recombinogenic site. While one of these sites is bound when present alone, the other site is bound only in conjunction with the first one, suggesting cooperative binding. In addition to the sites within the IR, Gin binds with lower affinity to AT-rich sequences adjacent to the IR. We demonstrate that these sites do not participate in the inversion reaction. The IR itself can be shortened to 25 bp without effect on inversion frequency. Using gel mobility shift experiments on circular permuted fragments containing the IR we show that Gin bends DNA upon binding. We discuss the possibility that DNA bending is related to the formation of a productive synaptic complex.

Base Sequence↗
PubMed1988

Structural requirements for the synthesis of tRNATrp from Dictyostelium discoideum in yeast.

Dictyostelium tRNA genes can generally be expressed in vivo in yeast. Among tested Dictyostelium tRNA genes a tRNATrp gene containing a 13 bp intron is transcribed with particularly poor apparent efficiency and the intron is not removed. Elimination of the intron from the gene increases the amount of transcription products significantly. Splicing can only occur if minimal base-pairing of the anticodon with intron sequences is possible. Accumulation of tRNA gene transcripts decreases with the inability of intron splicing. Products of neither amber (UAG) nor opal (UGA) suppressor variants of the tRNATrp gene from Dictyostelium are able to suppress corresponding non-sense mutations in defined structural yeast genes. This also holds true for suppressor tRNA gene variants with precisely deleted intron regions.

Dictyostelium↗
PubMed1987

Crystal structure analysis of an A-DNA fragment at 1.8 A resolution: d(GCCCGGGC).

Single crystals of the self-complementary octadeoxyribonucleotide d(GCCCGGGC) have been analysed by X-ray diffraction methods at a resolution of 1.8 A. The tetragonal unit cell of space group P4(3)2(1)2 has dimensions of a = 43.25 A and c = 24.61 A and contains eight strands of the oligonucleotide. The structure was refined by standard crystallographic techniques to an R factor of 17.1% using 1359 3 sigma structure factor observations. Two strands of the oligonucleotide are related by the crystallographic dyad axis to form a DNA helix in the A conformation. The d(GCCCGGGC) helix is characterized by a wide open major groove, a near perpendicular orientation of base pairs to the helix axis and an unusually small average helix twist angle of 31.3 degrees indicating a slightly underwound helix with 11.5 base pairs per turn. Extensive cross-strand stacking between guanine bases at the central cytosine-guanine step is made possible by a number of local conformational adjustments including a fully extended sugar-phosphate backbone of the central guanosine nucleotide.

Crystallization↗
PubMed1987

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.

Animals↗