PubMed Health⌕ Search

Biomedical subjects

H Busch

Publications and source records attributed to H Busch.

At least 19 recordsLinked to original sources
PubMed1992

A region of antisense RNA from human p120 cDNA with high homology to mouse p120 cDNA inhibits NIH 3T3 proliferation.

The human nucleolar p120 protein is a proliferation-associated antigen which is expressed in G1 and peaks during the early S phase of the cell cycle. Overexpression of the human p120 protein caused the transformation of NIH 3T3 cells and expression of an antisense p120 construct inhibited the growth of NIH 3T3 cells (Perlaky et al., Cancer Res., 52:428-436, 1992). The middle region of the antisense p120 RNA was found to be almost as inhibitory as the full length antisense construct but the 5' and 3' antisense portions did not affect NIH 3T3 cell proliferation. After the mouse p120 complementary DNA was cloned and sequenced, comparison with the human p120 complementary DNA showed a striking conservation of 85% of the nucleotide sequence and 96% of the amino acid sequence. The two ends of the p120 molecule had less homology in their nucleotide and amino acid sequences. Based on this homology, the observed inhibitory effects of the middle portion of antisense human p120 RNA may be related to suppression of mouse p120 expression by RNA:RNA duplex formation. The high evolutionary conservation of the middle region suggests it has a critical role for the function of this protein.

3T3 Cells↗
PubMed1992

Increased growth of NIH/3T3 cells by transfection with human p120 complementary DNA and inhibition by a p120 antisense construct.

The human nucleolar antigen p120 was detected with an anti-p120 monoclonal antibody in most human malignant tumors but not in most resting human tissues (J. W. Freeman et al., Cancer Res., 48: 1244-1251, 1988) and has been used as a prognostic tumor marker in breast cancer patients (J. W. Freeman et al., Cancer Res., 51: 1973-1978, 1991). After the complementary DNA and gene for the human p120 protein were isolated and sequenced (review: H. Busch, Cancer Res., 50: 4830-4838, 1990), constructs were prepared to study the expression of the sense p120 and its antisense, p021 message. NIH/3T3 cells were transfected by electroporation with pSVX plasmids containing either the p120 complementary DNA (pSVX120) or the antisense, p021 DNA (pSVX021), and clones containing these constructs were selected. The expression of p120 or p021 in these constructs was regulated by Moloney murine leukemia virus long terminal repeats. In pSVX120-transfected NIH/3T3 cells, the expressed human p120 protein was localized to the nucleoli as shown by anti-p120 monoclonal antibody immunofluorescence. Expression of the p120 message and protein was confirmed by Northern (mRNA) and Western (protein) blots. Transfection of the p120 complementary DNA in sense orientation caused malignant transformation of NIH/3T3 cells in vitro and produced rapidly growing tumors in nude mice. Transfection of the antisense p120 constructs markedly delayed the growth of these tumors in vitro and in vivo (L. Perlaky et al., Proc. Am. Assoc. Cancer Res., 32: 1682, 1991). When transformed 3T3/pSVX120 cells were transfected with an inducible antisense p120 construct (pMSG021), dexamethasone induction decreased the growth rate by 62%, and the cell line returned to its normal phenotype. Northern blot analysis showed a decreased level of p120 mRNA, and the immunofluorescence was also markedly reduced.

3T3 Cells↗
PubMed1991

Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.

Base Sequence↗
PubMed1991

Purification of a group of HeLa nuclear proteins that bind to a regulatory element (-1430/-1327) of the human proliferating cell nucleolar protein P120 gene.

A group of proteins was purified from HeLa nuclear extract by DNA affinity chromatography which bind to an important regulatory element (-1430/-1327) of the P120 gene. The DNA binding activity was enriched 1075 fold. By silver staining three major polypeptides (50, 40, 37 kDa) were detected in the purified fraction. The band shift assay and the southwestern assay showed that the 50 kDa protein (P50) binds to the F1 (-1430/-1327) DNA fragment. The binding specificity of the group of proteins with F1 DNA in the presence of non-specific competitor DNA is much higher than that of P50 alone. On the basis of molecular weight and specific antibody binding, the 37 kDa protein appears to be the B23 nucleolar protein.

Amino Acids↗
PubMed1991

Prognostic significance of proliferation associated nucleolar antigen P120 in human breast carcinoma.

Nucleolar antigen P120 is detected in rapidly proliferating cells but not in normal resting cells or in many benign and slowly growing malignant tumors. The objective of the study was to determine whether the expression of P120 in breast cancer correlated with histopathological or biological properties associated with prognosis. In this retrospective study, 120 primary breast tumors were analyzed for P120; 114 of these tumors were also stained for the erbB-2 protein. Immunopositive staining was correlated with patient survival, nodal status, estrogen receptor levels, and number of mitoses. Sixty-nine % (83 of 120) of the tumors were positive for P120; 25% (28 of 114) stained positively for erbB-2. Of the 28 erbB-2 positive tumors 26 were also positive for the P120 protein. Forty-six % (55 of 120) of the specimens were from patients who later died from recurrent breast cancer; P120 was detected in 89% (49 of 55) of these specimens. In 52% of the survivors the P120 protein was also expressed. P120 negative tumors were highly correlative with survival (P = 0.0001); 84% (32 of 37) of patients with P120 negative tumors survived more than 7 years without evidence of recurrent disease. Multivariate analysis showed that the worst prognosis was for patients who had tumor positive nodes and expressed P120 (P = 0.0001); death occurred in 73% (30 of 41) of these patients. For the node negative patients who did not express P120, 5-year survival was 90% (19 of 21 patients); 5-year survival for the node negative patients who expressed P120 was significantly less (67%; 28 of 42 patients). Patients with P120 negative tumors had a good prognosis, irrespective of their nodal status. In this group, survival of node negative patients was 86% (18 of 21) and for those with positive nodes survival was 82% (13 of 16). A poor prognosis was found for patients with intense erbB-2 stained tumors (5 of 7 patients died). Weak staining of erbB-2 tumors (21 specimens) was not correlated with patient survival. Compared to P120 negative tumors, P120 positive tumors had greater numbers of mitoses (9.06 versus 6.65) and an almost 2-fold increase in the occurrence of positive nodes (one of every 4.67 versus one of every 8.81). The number of P120 positive tumors was greater in estrogen receptor positive tumors (75%) than in estrogen negative tumors (54%).(ABSTRACT TRUNCATED AT 250 WORDS)

Biomarkers, Tumor↗
PubMed1991

[Suicide during inpatient psychiatric treatment].

Although psychiatric therapy has become more effective, in-patients' rate of suicide increased. The methodological deficits of studies has not allowed to derive a good preventive management until now. Results from literature to this topic are reviewed. In an own investigation concerning the suicides of in-patients of the Psychiatric University Hospital in Berlin from 1951 to 1983 we propose five types of constellation of suicide as a new possible procedure to elaborate the results. Preventive consequences and more adequate designs for further studies are discussed.

Adult↗
PubMed1991

Purification of a novel 55 kDa HeLa cell nuclear DNA-binding protein.

A novel 55 kDa DNA-binding protein (p55) was purified from HeLa cell nuclear extracts to apparent homogeneity by conventional chromatography coupled with DNA-affinity chromatography. The DNA-binding activity of p55, followed by band mobility shift and Southwestern assays, was enriched 800-fold. This relatively abundant protein was shown to bind nonspecifically to DNA. When added to nuclear extracts, p55 enhanced 2-fold the in vitro transcription of CAT reporter gene driven by the SV40 promoter. The sequence of the N-terminal 20 amino acid residues of purified p55 was determined as APSTPLLTV(P)G(S)EGLYMVNG, homologies could be found when compared to protein sequences available in all databanks.

Amino Acid Sequence↗
PubMed1991

Demonstration of estrogen and progesterone receptors as well as Ki-67 and p-145 antigens in single tumor cells from blood and pleural effusions using a slide assay.

We describe a slide assay that allows the demonstration of antigens localized in the nucleus from isolated white blood cells as well as from single tumor cells derived from malignant effusions. With the antibodies Ki-67 and anti-p-145 an increased rate of nuclear and nucleolar staining resulted in cells from highly malignant lymphomas. An almost identical reaction was obtained when tumor cells from malignant effusions were tested. Cells isolated from the blood of patients with leukemic spread of lymphomas of low malignancy yielded a weak staining comparable to that of normal mesothelial cells from non-tumorous cavity fluids. The detection of estrogen and progesterone receptors (ER and PR) localized in the cell nucleus can be achieved by the same assay. The reaction is enhanced by incubation of the tumor cells for 30 min at 37 degrees C prior to fixation. Pleural effusions from 20 patients with breast cancer were tested. ER was positive in 13 and PR was positive in 12 of the 20 samples. In 5 cases there was a divergent reaction with ER and PR antibody. The hormone receptors of the primary tumor were known in 15 (ER) and 14 (PR) patients, respectively. In each cohort there was only one case with a negative reaction of the primary tumor and a positive reaction with the isolated tumor cells from the pleural effusions. These results indicate that the demonstration of hormone receptor proteins in cells from malignant effusions is possible and that there is a correlation with the status of the primary site of cancer.

Breast Neoplasms↗
PubMed1991

Event-related potentials in HIV-infected outpatients.

Event-related potentials (ERP) were determined in 138 human immunodeficiency virus (HIV)-infected outpatients and 92 healthy controls of a corresponding age. Of the HIV-infected patients, 31.8% showed an abnormal latency of the P3-component of ERPs (P3-ERP), exceeding the mean value + 2 SD of P3-ERP latencies from age-matched healthy subjects. From the untreated patients in stage Walter Reed (WR) = 6, 71.4% had abnormal P3-ERP latencies, whereas in WR = 2, only 19.6% of P3-ERPs were abnormal. Fourteen patients were observed over a period of 3-16 months. P3-ERP latencies were shortened in 7 patients under treatment with zidovudine. A marked increase in P3-ERP latencies was observed in 7 untreated HIV-infected patients. It is assumed that ERPs are a useful neurophysiological method to detect early cerebral dysfunction in HIV-infected patients.

Adult↗
PubMed1991

Nucleolar protein P120 and its targeting for cancer chemotherapy.

Identification of the G1-P120 antigen with the aid of the monoclonal antibody to its "human-specific epitope" has resulted in rapid development of information on its molecular biology. With the monoclonal antibody, it rapidly became possible to identify and subsequently sequence its cDNA and with cDNA clones to isolate and sequence its genomic DNA. It was demonstrated that the protein had 4 major domains: a basic domain, an acidic domain, a hydrophobic and methionine-rich domain and a domain rich in cysteine and proline residues. In addition to a nuclear recognition signal, the epitope region is juxtaposed to phosphorylation sites. The epitope region contains the sequence Gln-Ala-Ala-Ala-Gly-Ile-Asn-Trp which is unique to the human P120 molecule; this may be a site for drug attack either by analogs to the region or by novel constructs based on antisense oligonucleotides. When tumor cells were transfected with antisense constructs of the P120 gene, growth rates were markedly reduced. 3T3 cells transformed by transfection with the P120 gene reverted to a nontransformed state by subsequent transfection and activation of a P120 antisense construct. Opportunities for control of malignant cells with antisense oligonucleotides are currently under study.

3T3 Cells↗
PubMed1991

DNA footprint enhancement using tandem binding sites.

A concatenated DNA fragment containing a five-repeat binding site was used for DNase I footprinting. Under the same conditions, the tandem repeat assay greatly enhanced the DNA footprint as compared with a native DNA sequence with only one binding site. This technique provides an approach for improving poor DNA footprints.

Base Sequence↗
PubMed1991

Monoclonal antibodies to human tumor nucleolar antigens: probes for studying biological function and determining clinical significance.

Using novel strategies, monoclonal antibodies (MAbs) were developed to two proliferation-associated nucleolar antigens. These two new antigens, termed P145 and P120, according to their molecular weights, were found in a broad range of tumor tissues. Overall, P120 was more restricted in its distribution than P145 because it was absent from many benign tumors and some malignant tumors. Using the MAbs as probes, antigens P145 and P120 were localized to separate nucleolar components. P145 was mainly associated with high molecular weight nucleolar RNPs. Antigen P120 was localized to a novel beaded microfibril found in a nucleolar residue fraction. DNAse and high salt treatment of this fraction provided optimal extraction of the P120 antigen. P145 and P120 differed from other proliferation-associated nuclear/nucleolar antigens identified by autoimmune sera and by other MAbs. In PHA stimulated lymphocytes, both antigens were expressed in early G1 prior to or concurrent with increased RNA Pol I transcription. Microinjection of tumor cells with the P120 MAb inhibited cell proliferation and blocked the appearance of nucleolar pleomorphism that is characteristic of tumor cells. Clinical studies showed that P145 was not detected in normal bone marrow but was expressed in leukemic marrows (AML); the percentage of P145 positive cells correlated with percentage of malignant blasts (Raza et al., Am. Soc. Hematology, 1990). Antigen P145 was detected in 10 of 39 marrows from patients in complete remission. This result suggested that these cells have a higher proliferative potential than normal stem cells.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1990

Phosphorylation of the human cell proliferation-associated nucleolar protein p120.

The human cell proliferation-associated nucleolar protein p120 was found in a variety of human cancer specimens but not in most normal resting cells. Polyclonal antibodies raised against bacterially expressed p120 were used to immunoprecipitate the p120 protein isolated from 32P-labeled HeLa cells. The p120 protein was phosphorylated at serine, threonine and tyrosine residues. A tryptic peptide map showed it contained three labeled peptides. One of these peptides comigrated with a p120 peptide phosphorylated in vitro by casein kinase II. This peptide was phosphorylated in vitro both at Ser-181 and Thr-185. This region is juxtaposed to the epitope site recognized by the anti-p120 monoclonal antibody.

Amino Acid Sequence↗
PubMed1990

Identification of an epitope region of the human proliferation-associated nucleolar antigen P120.

An epitope region, located at amino acid residues 173-180 (EAAA-GIQW), of a human cell proliferation-associated nucleolar antigen, P120, has been defined by mutational analysis and competition assays. A synthetic peptide corresponding to this epitope region completely blocks the binding of the anti-P120 antibody to Escherichia coli-expressed P120 and the HeLa nucleolar P120 protein. Adjacent peptides lack inhibitory effects. The antigenic site includes a hydrophilic residue and a hydrophobic stretch. The glutamyl and tryptophanyl residues in this region make major contributions to the binding of P120 to its antibody, since peptides lacking either the glutamyl or the tryptophanyl residue do not block the antibody binding to the P120 antigen. This study provides a basis for drug design for specific binding to the epitope region of the P120 protein.

Antigens, Nuclear↗
PubMed1990

Ca2+ and nucleotide dependent regulation of voltage dependent anion channels in the plasma membrane of guard cells.

Using the patch-clamp technique we discovered that the voltage dependent anion channels in the plasma membrane of guard cells are activated by a rise in cytoplasmic Ca2+ in the presence of nucleotides. Upon activation, these anion channels catalyse anion currents 10-20 times higher than in the inactivated state, thus shifting the plasma membrane from a K+ conducting state to an anion conducting state. Prolonged stimulation by depolarizing voltages results in the inactivation of the anion current (t1/2 = 10-12 s). We suggest that activation of the anion channel by Ca2+ and nucleotides is a key event in the regulation of salt efflux from guard cells during stomatal closure.

Adenosine Triphosphate↗
PubMed1990

Diseases of the vertebral arteries.

Case reports and postmortem neuropathological findings of a wide spectrum of diseases affecting the vertebral arteries, in particular vasculitis, traumatic lesions, degenerative changes and congenital abnormalities, are discussed.

Adult↗